Single cell suspension and antibody staining were performed as described above except for addition of 100 unit/ml SUPERase•InTM RNase Inhibitor (ThermoFisher) to all of the tissue-digestion/staining buffers to inhibit the strong ribonuclease activity in murine skin. One hundred dermal TRMs were sorted directly into lysis buffer included in SMART-Seq V4 Ultra Low Input RNA Kit for Sequencing (Takara), and cDNA was generated according to the commercial protocol. Detailed methods for library preparation, sequencing, and bioinformatic analysis are described in the Supplemental Materials and Methods .
Superase intm rnase inhibitor
Manufactured by Thermo Fisher Scientific
SUPERase•InTM RNase Inhibitor is a recombinant ribonuclease (RNase) inhibitor protein designed to protect RNA from degradation by RNase enzymes. It is an effective tool for preserving RNA integrity in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Smart seq v4 ultra low input rna kit for sequencing, by Takara Bio (1 mentions)
Quantstudio 1, by Thermo Fisher Scientific (1 mentions)
One step tb green primescript plus rt pcr kit perfect real time, by Takara Bio (1 mentions)
2 protocols using superase intm rnase inhibitor
1
Isolating Murine Dermal Tissue-Resident Memory T Cells
2
SARS-CoV-2 RNA Quantification by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture supernatant was mixed with an equal volume of 2×RNA lysis buffer (distilled water containing 0.4 U/μL SUPERase InTM RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl (pH 7.4), and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) or QuantStudio 1 (Thermo Fisher Scientific). The primers used in this experiment are as follows: (forward) AGCCTCTTCTCGTTCCTCATCAC and (reverse) CCGCCATTGCCAGCCATTC. Standard curves were prepared using SARS-CoV-2 RNA (105 (link) copies/μL) purchased from Nihon Gene Research Laboratories.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!