Log In Sign up
The largest database of trusted experimental protocols

Lenti x 293t

Manufactured by GE Healthcare
Visit Supplier
Sourced in United States

The Lenti-X 293T is a cell line developed for the production of lentiviral particles. It is a derivative of the HEK 293T cell line, which is commonly used for the production of various viral vectors, including lentivirus. The Lenti-X 293T cells are designed to provide high-titer lentiviral particle production with minimal cell toxicity.

Automatically generated - may contain errors

Lab products found in correlation

Turbofect, by Thermo Fisher Scientific (4 mentions) Penicillin, by GE Healthcare (2 mentions) Streptomycin, by GE Healthcare (2 mentions) Cosmic serum, by GE Healthcare (2 mentions) Lenti x 293t cells, by Takara Bio (2 mentions) Plenti cmv v5 luciferase, by Addgene (2 mentions) Control shrna shc002, by Merck Group (2 mentions) Granulocyte stem cell factor, by GoldBio (2 mentions) Txnrd1 shrna, by Merck Group (2 mentions) Plv crispr hcas9 t2a puro u6 htxnrd, by VectorBuilder (2 mentions) Ciprofloxacin, by Santa Cruz Biotechnology (1 mentions) Lenti x 293t, by Thermo Fisher Scientific (1 mentions) U87mg, by GE Healthcare (1 mentions) Panc 1, by GE Healthcare (1 mentions) Huh 7, by GE Healthcare (1 mentions) Penicillin streptomycin, by Welgene (1 mentions)

3 protocols using lenti x 293t

1

Characterizing AML cell lines and patient samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lenti-X 293T cells were purchased from Clontech. Lenti-X 293T and AML cell lines (HL60, OCIAML3, THP-1, MOLM13, MV411) were maintained in RPMI media supplemented with 10% cosmic serum (GE Healthcare) and 100U/ml Penicillin with 100μg/ml Streptomycin (GE Healthcare). MV411-luciferase cells were generated by stably transfecting MV411 cells using the plasmid pLenti-CMV V5-luciferase (Addgene). Patient samples were obtained from Hematopoietic biorepository and cellular therapy core at Case Western Reserve University. All work on human patient samples were approved by Institutional Review Board at University Hospitals Cleveland Medical Center. All patient samples were derived from bone marrow, had >60% leukemic blasts, and underwent ficoll purification to isolate mononuclear cells prior to testing. Primary leukemic cells were cultured in IMDM media (GE Healthcare) with 20% serum supplemented with 20ng/ml Granulocyte Stem cell factor (Gold Biotechnology). Transient transfections were performed using Turbofect (ThemoFisher Scientific) following manufacturer’s protocols. Stable transfections were obtained by using shRNA constructs - Control shRNA (SHC002) and TXNRD1 shRNA (TRCN0000046533 (#1) and TRCN0000046535 (#2)) from Sigma as well as the CRISPR construct pLV[CRISPR]-hCas9:T2A:Puro-U6>hTXNRD with the following guide sequence TATGTCGCTTTGGAGTGCGC from VectorBuilder.
Karunanithi S., Liu R., Hou Y., Gonzalez G., Oldford N., Roe A.J., Idipilly N., Gupta K., Amara C.S., Putluri S., Lee G.K., Valentin-Goyco J., Stetson L., Moreton S.A., Putluri V., Kavuri S.M., Saunthararajah Y., de Lima M., Tochtrop G.P., Putluri N, & Wald D.N. (2021). Thioredoxin Reductase is a major regulator of metabolism in leukemia cells. Oncogene, 40(33), 5236-5246.
+ Open protocol
+ Expand
2

Cultivation of Various Cell Lines

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The human embryonic kidney cell line 293T and the U87MG human glioma cell line were obtained from the American Type Culture Collection (Manassas, VA, USA). 293FT and Lenti-X 293T cells were purchased from Thermo Fisher Scientific (Waltham, MA, USA) and Takara Bio Inc. (Shiga, Japan), respectively. The A549 human non-small cell lung cancer cell line, PANC-1 human pancreatic cancer cell line, NCI-H1299 human metastatic lung cancer cell line, Huh7 human hepatocellular carcinoma cell line, and CSC2 human glioma stem cell line were obtained from various researchers as described previously17 (link)–21 (link). The 293T, 293FT, Lenti-X 293T, U87MG, PANC-1, and Huh7 cells were cultured in Dulbecco’s modified Eagle medium (DMEM; HyClone - GE Healthcare, Chicago, IL, USA). The A549 and NCI-H1299 cells were cultured in RPMI 1640 medium (HyClone). The CSC2 glioma stem cells were cultured as described previously20 (link). All media except that used to culture CSC2 were supplemented with 10% fetal bovine serum (HyClone), 1% penicillin/streptomycin (Welgene, Gyeongsan, Republic of Korea), and 10 μg/ml ciprofloxacin (Santa Cruz Biotech, Santa Cruz, CA, USA).
Seo Y., Kim S.S., Kim N., Cho S., Park J.B, & Kim J.H. (2020). Development of a miRNA-controlled dual-sensing system and its application for targeting miR-21 signaling in tumorigenesis. Experimental & Molecular Medicine, 52(12), 1989-2004.
+ Open protocol
+ Expand
3

Characterizing AML cell lines and patient samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lenti-X 293T cells were purchased from Clontech. Lenti-X 293T and AML cell lines (HL60, OCIAML3, THP-1, MOLM13, MV411) were maintained in RPMI media supplemented with 10% cosmic serum (GE Healthcare) and 100U/ml Penicillin with 100μg/ml Streptomycin (GE Healthcare). MV411-luciferase cells were generated by stably transfecting MV411 cells using the plasmid pLenti-CMV V5-luciferase (Addgene). Patient samples were obtained from Hematopoietic biorepository and cellular therapy core at Case Western Reserve University. All work on human patient samples were approved by Institutional Review Board at University Hospitals Cleveland Medical Center. All patient samples were derived from bone marrow, had >60% leukemic blasts, and underwent ficoll purification to isolate mononuclear cells prior to testing. Primary leukemic cells were cultured in IMDM media (GE Healthcare) with 20% serum supplemented with 20ng/ml Granulocyte Stem cell factor (Gold Biotechnology). Transient transfections were performed using Turbofect (ThemoFisher Scientific) following manufacturer’s protocols. Stable transfections were obtained by using shRNA constructs - Control shRNA (SHC002) and TXNRD1 shRNA (TRCN0000046533 (#1) and TRCN0000046535 (#2)) from Sigma as well as the CRISPR construct pLV[CRISPR]-hCas9:T2A:Puro-U6>hTXNRD with the following guide sequence TATGTCGCTTTGGAGTGCGC from VectorBuilder.
Karunanithi S., Liu R., Hou Y., Gonzalez G., Oldford N., Roe A.J., Idipilly N., Gupta K., Amara C.S., Putluri S., Lee G.K., Valentin-Goyco J., Stetson L., Moreton S.A., Putluri V., Kavuri S.M., Saunthararajah Y., de Lima M., Tochtrop G.P., Putluri N, & Wald D.N. (2021). Thioredoxin Reductase is a major regulator of metabolism in leukemia cells. Oncogene, 40(33), 5236-5246.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!