Anti histone h3 antibody positive control

The chromatin immunoprecipitation assay was conducted by a SimpleChiP™ Enzymatic Chromatin IP kit (Cell Signaling Technology, Danvers, MA, USA). In short, cells were cross‐linked by 37% formaldehyde for 15 min at 37°C, used glycine to quench the cross‐linking reaction, and then gathered the cells. The cross‐linked chromatin was digested until a length of around 150–900 bp with the micrococcal nuclease added to the collected cells. The cross‐linked chromatin was then, respectively, incubated with 10 μl of anti‐RUNX2 antibody (Cell Signaling Technology), 1 μl of anti‐IgG antibody (negative control, Cell Signaling Technology), or 10 μl of anti‐histone H3 antibody (positive control, Cell Signaling Technology) overnight at 4°C in rotation and incubated with Protein A/G‐Sepharose for 2 h. Beads were then recovered by centrifugation and washed two times with ChIP Wash Buffer. The antibody/protein/DNA cross‐link complexes were reversed by heating at the temperature of 65°C for 2 h, and DNA Purification Kit was performed to purify the DNA (Cell Signaling Technology, Danvers, MA, USA). Purified DNA was scrutinized by RT‐qPCR with promoter‐specific primers (forward and reverse, respectively): SCD1 Primer 1 (5′‐ CCAGTCAACTCCTCGCACTT‐3′ and 5’‐AAGGCTAGAGCTGGCAACG‐3′), SCD1 primer 2 (5’‐CCATTGTTCGCAGGCGTACC‐3′ and 5′‐ ACATCTCCGTCCCGTCTTCC‐3′).

The chromatin immunoprecipitation (Chip) assay was performed using a SimpleChiP™ Enzymatic Chromatin IP kit (Cell Signaling Technology, Danvers, MA, USA) according to the manufacturer's protocol. Cells (4 × 10⁷) in five 150-mm culture dishes were treated with 1% formaldehyde to cross-link proteins to DNA and were collected. The chromatin was digested by micrococcal nuclease to a length of approximately 150-900 bp. The cross-linked chromatin was separately incubated with 10 μL of anti-NF-κB p50 antibody (Cell Signaling Technology), 3 μL of anti-IgG antibody (negative control, Cell Signaling Technology), or 3 μL of anti-histone H3 antibody (positive control, Cell Signaling Technology) overnight at 4°C with rotation. Protein G agarose beads were used to harvest the immunoprecipitant. After reverse cross-linking of protein/DNA complexes to free the DNA, qRT-PCR was performed using promoter-specific forward and reverse primers (Supplementary Table S2). RPL30 (provided by the kit) was used as an internal reference. Precipitated DNA was also amplified for 25 cycles and was resolved on 1% agarose gel to evaluate the amplification of target DNA.