Rna isolation kit

RNA was isolated from liver tissues postmortem using an RNA isolation kit (Zymo Research, California, USA) according to the manufacturer’s instructions. The quality and concentration of the RNA were evaluated by microcapillary electrophoresis using the Agilent Bioanalyser 2100 (Agilent), before cDNA synthesis (AzuraQuant). The expression of genes associated with inflammation, oxidative stress, and apoptosis was evaluated (in triplicates) by quantitative reverse transcription polymerase chain reaction (PCR) using AzuraView GreenFast quantitative PCR reagents (Azura Genomics, USA) and a custom-made PCR array (RealTimePrimers, Elkin Park PA, USA). The tested genes were summarized in table S1. Gene expression was estimated using the Livak method (53 (link)). The ΔCT values were calculated by normalizing values for each gene to the housekeeping genes, and ΔΔCT was calculated by normalizing the ΔCT values of the NP exposed sample in relation with control untreated sample. The data related to expressed genes were plotted as a function of log fold change, compared to control (uninjected) mice. Significant differences in gene expression in liver and spleen between mice pre-injected with empty liposomes and mice pre-injected with clodronate-encapsulated liposomes were established using the Student’s t test.

Total RNA was purified with the RNA Isolation Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions. The RNA concentration was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific). First-strand cDNA was prepared from an RNA template (500 ng) using the iScript cDNA Synthesis Kit (Bio-Rad). Reverse transcription was performed at 25 °C for 5 min, at 46 °C for 20 min, and then at 95 °C for 1 min. qPCR was performed using the CFX Connect ^TM Real-Time PCR Detection System (Bio-Rad). RT-qPCR was performed using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) to detect gene expression. The first step was 95 °C for 3 min; the second step was 95 °C for 15 s and 60 °C for 30 s, repeated 40 times. Each gene was normalized with GAPDH and analyzed. The primer sequences are shown in Table 2.

S2R+ were grown in 10 cm dishes and cross linked using a Stratalinker (Stratagene, San Diego, CA). After washing twice in cold 1X PBS cells were lysed in IP buffer [20 mM HEPES, pH 7.4; 50 mM KCl, 0.02% Triton X-100, 1% NP-40 (sub), 1 mM EDTA, 0.5 mM EGTA, 5% glycerol] supplemented with 1 mM DTT. Extract was incubated with oligo-dT magnetic beads to isolate mRNAs. mRNA was eluted and the 2nd step of the immunoprecipitation was performed using anti-Clu antibody or IgG-guinea pig as a control. Total RNA as well as Clu-bound mRNAs were isolated using RNA isolation kit (Zymo Research, Irvine, CA). RNA was stored at −80°C until further use. RT-PCR was performed using NEB one-step RT-PCR kit (New England Biolabs, Cat #E5315S) and gene specific primers (Supplementary Figure S10) for the following genes: ND-19, ND-ASHI, ND-SGDH, ND-42, ND-23, UQCR-14, UQCR-Q, CYP4AC2, COX4, COX5B, LEVY, HSP22, mRpS16, ATPsynCF6, and TOM20.

Total RNA was extracted using RNA Isolation Kit (Zymo Research, Irvine, CA, USA). After reverse transcription (Thermo Fisher Scientific), the mixture containing 1 μg of cDNA and SYBR Green (Thermo Fisher Scientific) was subjected to qPCR by PCR machine (Thermo Fisher Scientific) using primers targeting AR: F: CGGAAGCTGAAGAAACTTGG; R: ATGGCTTCCAGGACATTCAG.