Pcr2.1 topo
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Japan, United Kingdom
The PCR2.1-TOPO is a cloning vector designed for the direct cloning of Taq polymerase-amplified PCR products. It provides a quick and efficient method for the cloning of PCR fragments without the need for restrictive enzyme digestion or ligation.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Qiaquick gel extraction kit, by Qiagen (5 mentions)
T4 dna ligase, by New England Biolabs (5 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (4 mentions)
Pqe30, by Qiagen (4 mentions)
Taq polymerase, by New England Biolabs (4 mentions)
Platinum pcr supermix, by Thermo Fisher Scientific (4 mentions)
Chargeswitch pcr clean up kit, by Thermo Fisher Scientific (4 mentions)
Qiaprep spin miniprep kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Taq polymerase, by Thermo Fisher Scientific (3 mentions)
Pcdna3, by Thermo Fisher Scientific (3 mentions)
Pgem t easy, by Promega (3 mentions)
5 race system, by Thermo Fisher Scientific (3 mentions)
Quikchange 2 xl, by Agilent Technologies (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Ez dna methylation gold kit, by Zymo Research (2 mentions)
Ez dna methylation kit, by Zymo Research (2 mentions)
Pcr blunt 2 topo, by Thermo Fisher Scientific (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
217 protocols using pcr2.1 topo
1
Generating kin-29 Transcriptional Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
kin-29cDNA was generated by PCR amplifying 3323 bp of the ges-1 promoter using wild type genomic DNA as template with the following primers: 5′-ctcgagctaagcttaatgaagtttatttc -3′ (XhoI site underlined) and 5′-ggatccctgaattcaaagataagatatgt-3′(BamHI site underlined). The PCR product was cloned into pCR2.1-TOPO (Invitrogen), cut out with XhoI and BamHI, and ligated into pBluescriptKS–. The 2468-bp kin-29cDNA was amplified from Pkin-29::kin-29cDNA::GFP (a kind gift from Piali Sengupta) with the following primers: 5′-ggatccatggctgcgccacggcggc-3′ (BamHI site underlined) and 5′-gcggccgctcactccgagctccagcttg-3′(NotI site underlined). The PCR product was cloned into pCR2.1-TOPO (Invitrogen), cut out with BamHI and NotI and ligated into the pBluescriptKS– vector containing the promoter of ges-1 (Pges-1). A 744-bp fragment of the unc-54 3′UTR was generated by PCR amplification using wild type genomic DNA as template with the following primers: 5′-gcggccgccatctcgcgcccgtgcctc-3′(NotI site underlined) and 5′-gcggccgcaaacagttatgtttggtat-3′ (NotI site underlined). The PCR product was cloned into pCR2.1-TOPO (Invitrogen), cut out with NotI and ligated into Pges-1::kin-29cDNA;pBluescriptKS– creating Pges-1::kin-29cDNA::unc-54 3′UTR. The plasmid was injected into ceh-10 ;kin-29 at 25 ng/μl together with 2 ng/μl Pmyo-2::mCherry.
+ Expand
2
Characterizing 3'UTR Sequence and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3’RACE was used to determine the sequence of the 3’UTR. Fragments were obtained by PCR using a 3’RACE primer (GGCCACGCGTCGACTAGTAC) and a gene-specific primer, followed by a PCR with a nested gene-specific primer (primers see Table 1 ). The obtained fragments were cloned into PCR®2.1 TOPO® (ThermoFisherScientific) and sequenced.
1 ). These sequences were cloned into PCR2.1® TOPO® (ThermoFischer Scientific) under the T7 promoter and used to prepare digoxigenin-labelled RNA probes. Pictures were taken with a Leica DM6000 microscope and processed with Fiji (ImageJ).
Primers used for the 3’RACE and RNA in situ hybridisation. Primers to obtain the 3’UTR sequence as well as to generate the in situ RNA probes are shown
| In situ probes | Fw | R |
|---|---|---|
| ThAP3 | CTCTCCATTCTCTGCGACGCTAG | CATCAAGCTAGGTTTTTCAACTCC |
| ThPI-1 | GCTCTCCTTCAATGGATCTTGGTG | CACTTATGTCCAAGTCCTTGCAGAG |
| ThPI-2 | GATCACTGTTCTATGCGACGCC | GAAACACGCAACGAACCTTGTC |
| 3’ RACE | First PCR | Nested PCR |
| ThAP3–1 | CTCACTACGAAAGGATGCAAGAGAC | GAAGTTTAAATCGATTGGCAGCC |
| ThAP3–2 | CCTCTCACTACGAAAGGATGCAG | CGATTGGCAATAAAATTGAAACC |
| ThPI-1 | GAGCAGTATCAAAGGATCGCC | GGCCATAGAGCACGCAGTCC |
| ThPI-2 | GAGATGTTGGGCACTTATCAGC | CAAAAGCCTAATCGCCATAGAGAG |
3
Construction of H7N9 Influenza Virus Antigens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HA and NA genes of A/Shanghai/2/2013 (H7N9) influenza virus were amplified by PCR flanked with AatII/MluI binding sites using pCAGGS-H7 and pCAGGS-N972 ,73 as templates and primer pairs H7 fwd / H7 rev and N9 fwd / N9 rev (Supplementary Tab. 1 ), respectively. Amplicons were cloned into pCR2.1-TOPO (Invitrogen Life technologies) according to manufacturer´s instructions, and fully sequenced. Both antigens, as well as the CMV promotor74 (link), were inserted into p(+)BR-MVvac2-GFP(H) or p(+)MVvac2-ATU(P)75 (link) via AatII/MluI or SfiI/SacII, respectively, to generate p(+)PolII-MVvac2-H7(H), p(+)PolII-MVvac2-H7(P), p(+)PolII-MVvac2-N9(H), or p(+)PolII-MVvac2-N9(P). Thereby, the influenza virus antigens are encoded by measles genomes possessing otherwise Moraten and Schwarz vaccine strain-identical coding capacity. For construction of lentiviral transfervectors encoding H7, N9, or MeV nucleocapsid protein N, the respective ORFs were amplified by PCR with primers H7fwdNheI/H7revXhoI or N9fwdNheI/N9revXhoI (Supplementary Table 1 ), respectively, encompassing flanking NheI/XhoI restriction sites. PCR products were cloned into pCR2.1-TOPO (Invitrogen Life technologies) and fully sequenced. Intact antigen ORFs were cloned into pCSCW2gluc-IRES-GFP76 (link) using NheI/XhoI restriction sites to yield pCSCW2-H7-IRES-GFP, pCSCW2-N9-IRES-GFP, or pCSCW2-MV-N-IRES-GFP, respectively.
4
Genetic Engineering of C. albicans Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PMR1 ORF was amplified by PCR using the primer pair 5′-AAGCTT ATGAGTGATAACCCTTATGAACTA-3′ and 5′-GCTAGC TTATACTCCATATGTATAATTATTAGTATAAATAG T-3′ (underlined sequences correspond to restriction sites for HindIII and NheI, respectively); while OCH1 ORF was amplified with the primer pair 5′-AAGCTT ATG CGTCTGAAGGATATCA-3′ and 5′- GCTAGC TTAATCTTCC ATTTCTGGCAT (underlined sequences correspond to restriction sites for HindIII y NheI, respectively). The amplicons were cloned into pCR®2.1-TOPO® (Invitrogen), and subcloned into the HindIII and NheI sites of pACT1 (Barelle et al., 2004 (link)), generating pACT1-CtPMR1 and pACT1-CtOCH1. A C. albicans pmr1Δ null mutant (Bates et al., 2005 (link)) was transformed with StuI-digested pACT1-CtPMR1, generating strain HMY185; whereas a C. albicans och1Δ null mutant (Bates et al., 2006 (link)) was transformed with StuI-digested pACT1-CtOCH1, generating the strain HMY148. Since the OCH1 ORF contains an internal recognition site for HindIII, after cloning into pCR®2.1-TOPO® (Invitrogen), the codon 450AAA453 was modified to 450AAG453 by site-directed mutagenesis using the Phusion Site-Directed Mutagenesis Kit (Thermo) and the primer pair 5′- CCTGATGTTTCAAGGCTTATAAAATTATGCCAAAATC-3′ and 5′- GGCATAATTTTATAAGCTTTGAAACATCAGGAA TTTC-3′. The mutation was confirmed by DNA sequencing, before cloning into pACT1.
5
HIV-1 RT Mutant Virus Production
6
HIV-1 RT Mutant Virus Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RT coding region of the pol gene of plasmids encoding the HIV-1NL4–3 with a deletion in env and the luciferase gene in place of nef (NLdE-luc) (48 (link)) or full-length HIV-1NL4–3 or HIV-1NL4-BAL proviruses were amplified by PCR and were subcloned into pCR2.1-TOPO (Life Technologies). RT mutations E138K, V179I, Y181C, Y181V, E138K/V179I, V179I/Y181C, and V179I/Y181V were introduced into these plasmids using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies). After verification by Sanger sequencing, the mutated fragment was cloned into the plasmids.
WT and mutant viruses were produced by transfection of 293T cells using Lipofectamine 2000 (Thermo Fisher Scientific). NLdE-luc viruses were pseudotyped with VSV-G, using the pLVSV-G plasmid. Virus-containing supernatants were harvested 48h after transfection.
WT and mutant viruses were produced by transfection of 293T cells using Lipofectamine 2000 (Thermo Fisher Scientific). NLdE-luc viruses were pseudotyped with VSV-G, using the pLVSV-G plasmid. Virus-containing supernatants were harvested 48h after transfection.
7
Recombinant Expression of GAK and Nbs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNA fragment containing the kinase domain (25–335) of the human GAK gene (OriGene Technologies, USA) was amplified by means of PCR and sub‐cloned into the expression vector pCR2.1TOPO (Life Technologies, USA) with an N‐terminal fusion consisting of an N‐terminal “N11‐tag” (MKDHLIHNHHKHEHAHAEH, affinity tag for nickel resin) and a TEV protease cleavage site. Genes encoding the Nbs were converted from two amino acid sequences (PDB ID: 4C57 and 4C58) and synthesized by Eurofins Genomics (Japan), and the DNA fragments were amplified and sub‐cloned in a similar way to GAK.
8
Bisulfite Sequencing of CD4 DHS3 Region
9
Bisulfite-Sequencing and Methylation-Specific PCR
10
Recombinant Expression and Purification of DENV NS5 Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA fragments encoding the full-length NS5 proteins, comprising the N-terminal MTase and the C-terminal RdRp, from DENV1, DENV3, and DENV4 were synthesized (Eurofins Genomics), and cloned into the expression vector pCR2.1 TOPO (Life Technologies) with N-terminal His- and SUMO-tags, and a SUMO protease cleavage site. The expression vector pET Duet-1 (Novagen), which contains a DNA fragment encoding the full-length DENV2 NS5 with an N-terminal His-tag and a TEV protease cleavage site, was purchased from GenScript. These amino-acid sequences, the synthesized ORF DNA sequences, and the sequences of the primers used in this study are shown in S7 Fig , S9 Fig , and S2 Table . The NS5 proteins were expressed in the E. coli strain KRX, cultured in terrific broth medium. When the culture reached an OD600 of 0.4–0.6, the protein expression was induced by adding 0.5 mM IPTG and 0.1% rhamnose, and the culture was continued for 1–2 days at 18°C. The protein purifications were performed as described above, except that SUMO protease was used instead of TEV protease when appropriate. The final protein samples are >95% pure, as judged by SDS-PAGE analyses (S10 Fig ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!