Total RNA is reverse transcribed using RevertAid Reverse Transcriptase (Thermo Fisher Scientific, MA, USA) with 100–1,000 ng of input RNA and random primers (Thermo Fisher Scientific, MA, USA). Quantitative real-time PCR reactions (qRT-PCR) are performed in 384-well plates using specific primers (TIB MOLBIOL, Germany) (Supplementary Table S1 ) and the iQTM SYBR® Green Supermix (BioRad, CA, USA) as a fluorescent detection dye in a final volume of 10 μl [CFX96TM Real-Time PCR (BioRad, CA, USA)]. Each reaction is performed in triplicate. All results are normalized to β-actin or Gapdh mRNA levels and calculated using the 2−ΔCt method. To characterize generated amplicons and to control contamination by unspecific by-products, melt curve analysis is applied.
Cfx96 real time pcr
Manufactured by Bio-Rad
Sourced in United States, United Kingdom, Italy
The CFX96 Real-Time PCR is a thermal cycler used for quantitative real-time polymerase chain reaction (qPCR) analysis. It is capable of detecting and quantifying target DNA sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Rneasy mini kit, by Qiagen (8 mentions)
Iscript cdna synthesis kit, by Bio-Rad (8 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (6 mentions)
Cfx manager software, by Bio-Rad (6 mentions)
Iqtm sybr green supermix, by Bio-Rad (4 mentions)
Random primer, by Thermo Fisher Scientific (4 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Iq sybr green supermix, by Bio-Rad (4 mentions)
Sypro orange, by Merck Group (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Taqman gene expression cells to ct kit, by Thermo Fisher Scientific (3 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Protoscript 2 first strand cdna synthesis kit, by New England Biolabs (3 mentions)
Premix ex taqtm 2 tli rnase h plus kit, by Bio-Rad (2 mentions)
Cfx manager 3.1 real time pcr system, by Bio-Rad (2 mentions)
Direct zol rna miniprep kit, by Zymo Research (2 mentions)
Quantifast rt mix, by Qiagen (2 mentions)
107 protocols using cfx96 real time pcr
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR reactions were performed in triplicate in 96-well plates using specific primers (TIB MOLBIOL) and the iQTM SYBR® Green Supermix (BioRad) as a fluorescent detection dye, in CFX96TM Real-Time PCR (BioRad), in a final volume of 12.5 μl. The input amount of genomic DNA used in each well was 35 ng. To characterize generated amplicons and to control contamination by unspecific by-products, melt curve analysis is applied. All results were normalized to GAPDH level and calculated using the ΔΔCT method. Primer sequences are GAPDH Fwd: CGAGATCCCTCCAAAATCAA; GAPDH Rev: AGGCATTGCTGCAAAGAAAG; RYR2 Fwd: TGCGTGCTGGCTACTATGAC; RYR2 Rev: TGCTTCAAGTCCTCGTTGTG.
3
Modulation of Glucose Transporters in Caco-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Caco-2 cells were incubated with serum and glucose-free DMEM for 2 h and subsequent incubation with the LS extract (125–250 µg/mL) in serum-free medium for 16 h (Alzaid et al. 2013 (link)). Then, total RNA from Caco-2 cells was extracted using RiboZol reagent (Solon, OH, USA) and the cDNA was synthesized using an ImProm-IITM Reverse Transcription System kit (Promega, VIC, Australia) based on the manufacturer’s instructions. SGLT1, GLUT2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression were analyzed by CFX96TM Real-Time PCR (Bio-Rad Laboratories, Inc., Hercules, USA) using SsoFastTM EvaGreen® Supermix kit. Thermocycling conditions were set at an annealing temperature of 59.5 °C at 40 PCR cycles for GAPDH and at an annealing temperature of 56.4 °C for 60 PCR cycles for SGLT1 and GLUT2. Quantitative measurements of glucose transporter relative to GAPDH gene expression were derived using the 2−ΔΔCT method. The data were expressed as the relative to untreated control group.
4
Validating RNA-Seq Data Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the RNA-Seq data, we randomly selected 2 of circRNA and 2 of miRNA for qRT-PCR analysis. Total RNA was extracted from each skin tissue sample, and then reverse-transcribed into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instruction.
Quantitative PCR (qPCR) was performed using the SYBR®, Premix Ex TaqTM II (Tli RNase H Plus) Kit with a Bio-Rad CFX Manager 3.1 real-time PCR system (CFX96TM Real-Time PCR, Bio-Rad, United States). The circRNA expression were normalized to GAPDH as an endogenous reference transcript, the miRNA expression were normalized to that of U6 (Zhong et al., 2019 (link)). The relative expression levels of circRNA and miRNA were calculated using the 2–ΔΔCt method. The specific primers for each gene are listed inSupplementary Table 2 . Data shown represent the means of 3 experiments.
Quantitative PCR (qPCR) was performed using the SYBR®, Premix Ex TaqTM II (Tli RNase H Plus) Kit with a Bio-Rad CFX Manager 3.1 real-time PCR system (CFX96TM Real-Time PCR, Bio-Rad, United States). The circRNA expression were normalized to GAPDH as an endogenous reference transcript, the miRNA expression were normalized to that of U6 (Zhong et al., 2019 (link)). The relative expression levels of circRNA and miRNA were calculated using the 2–ΔΔCt method. The specific primers for each gene are listed in
5
Quantifying Marburg Virus RNA in Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On the day of collection, harvested serum (0.05 mL) was added to TRIzol® LS (5X volume; i.e., 0.25 mL) and stored at ≤−65 °C until RNA exaction. RNA was extracted from samples using the Zymo Research Direct-zol™ RNA MiniPrep kit (Zymo Research, Irvine, CA, USA). For sample quantification, each assay plate contained a standard curve prepared using MARV VP40 gene synthetic RNA (1.0 × 103 to 1.0 × 1010 genome equivalents/µL [GEq/µL] in duplicate wells). For the qRT-PCR, QuantiFast Probe RT-PCR Master Mix and QuantiFast RT Mix (Qiagen, Ilden, Germany) were used in conjunction with Forward primer: 5′- CCAgTTCCAgCAATTACAATACATACA-3′, Reverse primer: 5′- gCACCgTggTCAgCATAAggA-3′ and Probe: 5′-6FAM- CAATACCTTAACCCCC-MGBNFQ-3′. Primers and probe targeted the VP40 gene from MARV (GenBank accession no. DQ447660). The qRT-PCR was conducted on a Bio-Rad CFX96TM Real-Time PCR.
6
Quantitative RT-PCR Analysis of Bovine Granulosa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatments, granulosa cells were harvested for total RNA extraction using Trizol reagent (Takara, Kusatsu, Japan). After quantifying with a spectrophotometer (Thermo, Waltham, MA, USA), the first-strand cDNA was synthesized using 5 × All-In-One RT MasterMix (Abm, Vancouver, Canada). The targeted cDNA was quantified by CFX96TM Real-Time PCR (Bio-Rad, Hercules, CA, USA) using the EvaGreen 2 × qPCR MasterMix-no Dye (Abm, Vancouver, Canada). The bovine-specific primer sequences for target genes are listed in Table 1 . The β-actin was used as a reference gene. The quantitative real-time PCR protocol was as follows: 30 s at 95 °C; 40 cycles of 5 s at 95 °C; and 30 s at 60 °C. Relative expression of target genes was calculated using the 2△△Ct method.
7
Quantifying Gene Expression in Bovine Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pool of 50 oocytes were added to 6 μL of Lysis buffer (5 mmol/mL dithiothreitol, 20 U/mol RNase inhibitor, 1% NP-40). Total RNA was extracted by repeated pipetting on ice for 20 min. According to the instruction procedure, the first-strand complementary DNA (cDNA) was synthesized with a PrimeScript TM RT Reagent Kit with genomic DNA Eraser (Takara, Kusatsu, JP) on ice. After reversing transcription of the total RNA, the targeted cDNA was performed using CFX96TM Real-Time PCR (Bio-Rad, Hercules, CA, USA) with the SYBR Premix Ex TaqII (2×) Reagent Kit (Takara, JP). The bovine-specific primers for target genes for real-time PCR were listed in Table S1 . The thermal cycling parameters for Real-Time PCR were performed in our previously described protocol [72 (link)]. Based on the threshold cycle (CT) value of each gene, the mRNA expression was calculated by using the ΔΔCt method. The GAPDH gene was used as a housekeeping gene for each sample, and the results are represented as the target gene ratio to GAPDH levels.
8
Quantifying Senescence-Associated Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded in 10 cm cell culture dishes at 5 × 105 cells per dish. To detect senescence-associated changes of cell cycle inhibitors, total RNA extraction was performed using peqGOLD TriFast™ reagent (Peqlab) according to the manufacturer’s protocol. Two-step RT-qPCR was conducted as earlier described [14 (link), 15 (link)]. Briefly, the cDNA was first synthesized using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The PCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad), gene specific primers, and Bio-Rad CFX96TM real-time PCR (RT-qPCR) detection system with 4 technical replicates normalized to TBP mRNA. The primer sequences are listed as 5′ → 3′:
TBP: fwd: GGCGTGTGAAGATAACCCAAGG
rev: CGCTGGAACTCGTCTCACT
KLK3: fwd: GAGGCTGGGAGTGCGAGAAG
rev: TTGTTCCTGATGCAGTGGGC
FKBP5:fwd: GAGGAAACGCCGATGATTGGAGAC
rev: CATGCCTTGATGACTTGGCCTTTG
CDKN2A: fwd: CTTGCCTGGAAAGATACCG
rev: CCCTCCTCTTTCTTCCTCC
9
Quantitative RT-PCR Validation of Microarray
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Confirmation of microarray results was performed by quantitative real-time PCR. Total RNA was reverse-transcribed using RevertAid Reverse Transcriptase (Thermo Scientific) with 100–1000 ng of input RNA and random primers (Thermo Scientific). Quantitative real-time PCR reactions were performed in 96-well plates using specific primers (TIB MOLBIOL) and the iQTM SYBR® Green Supermix (BioRad) as a fluorescent detection dye, in CFX96TM Real-Time PCR (BioRad), in a final volume of 12.5 μl. To characterize generated amplicons and to control contamination by unspecific by-products, melt-curve analysis was applied. Each reaction was performed in duplicate. All results were normalized to PGK1 mRNA level and calculated using the ΔΔCt method. The specificity of the PCR was determined by melt-curve analysis for each reaction.
10
Yeast gene expression analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from ~4.5 × 107 yeast cells by glass bead beating using the RNeasy mini kit (QIAGEN). Five hundred nanograms of total RNA was used as starting material for cDNA synthesis using SuperScriptTM III First-Strand Synthesis System Kit (Thermo Fisher Scientific; Cat. No. 18080051). Quantitative real-time PCR was performed on CFX96TM Real-Time PCR (Bio-Rad) in a 96-well plate. Twenty microliters of PCR reactions were prepared with 2X mastermix and 20X Taqman assay (PUT6 assay ID: Sc04120572_s1, PUT7 assay ID: Sc04148698_s1, PUT1 assay ID: Sc04147047_s1, and ACT1 assay ID: Sc04120488_s1) from Applied Biosystems. The mRNA levels were normalized to ACT1 expression levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!