The levels of miR-124a and BRD4 in the whole blood and cells were measured by qRT-PCR. Total RNA was isolated from serum samples using a miRVana PARIS kit (Ambion, Austin, TX, USA) according to the manufacturer's instructions. The cells treated with TRIzol reagent for extraction of total RNAs, and adherent cells were treated with trypsase before RNA extraction. After that, the total RNA in the extracts were transcribed as cDNAs by a PrimeScript® RT reagent Kit (Thermo Fisher, Massachusetts, USA). The primers of miR-124a and BRD4 synthesized by a PrimeScript® RT reagent Kit (Thermo Fisher, Massachusetts, USA) were used in the experiment. The reaction systems (10 μl) of qRT-PCR were prepared according to the operational instruction of a KAPA qRT-PCR kit (Sigma-Aldrich, Missouri, USA). U6 was used as the endogenous controls. The following conditions were used: denaturation at 95°C for 3 min, followed by amplification for 40 cycles at 95°C for 12 s and at 53°C for 40s, and 70°C for 30s. The relative levels of miRNA or mRNA were calculated with the 2−(ΔΔCt) method [14 (link)]. The primer sequences of miR-124a, BRD4, and U6 are listed in Table 1 .
Primescript rt reagent kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Japan, Lithuania
The PrimeScript RT Reagent Kit is a reagent kit designed for reverse transcription of RNA to cDNA. The kit includes essential components for the reverse transcription reaction, including a reverse transcriptase enzyme, random hexamers, and other necessary reagents.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (162 mentions)
Trizol, by Thermo Fisher Scientific (39 mentions)
Sybr premix ex taq, by Takara Bio (25 mentions)
Sybr premix ex taq 2, by Takara Bio (13 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (10 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (10 mentions)
Cfx96 quantitative pcr system, by Bio-Rad (10 mentions)
Sybr green master mix, by Thermo Fisher Scientific (9 mentions)
Sybr green pcr kit, by Takara Bio (7 mentions)
Abi 7900ht real time pcr system, by Thermo Fisher Scientific (5 mentions)
Kapa qrt pcr kit, by Merck Group (5 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Sybr green real time pcr master mix, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Qubit 3, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr kit, by Thermo Fisher Scientific (4 mentions)
Taqman microrna assay kit, by Thermo Fisher Scientific (4 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq kit, by Takara Bio (4 mentions)
Abi prism 7500 pcr system, by Thermo Fisher Scientific (4 mentions)
283 protocols using primescript rt reagent kit
1
Quantifying miR-124a and BRD4 Levels
2
Quantitative Analysis of mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was homogenized in TRIzol and isolated from mouse kidneys or human plasma according to the manufacturer's protocol. Reverse transcription was performed using the Superscript III Reverse Transcription System (Invitrogen) for mRNA or PrimeScript RT reagent Kit for miRNA, and real‐time PCR analysis was performed using SYBR Green or Taqman quantitative kit (Applied Biosystems, Alameda, CA). The sequence of primers for detecting mRNA was listed as following: TNF‐α: F‐5ʹ‐ACGGCATGGATCTCAAAGAC‐3ʹ; R‐5ʹ‐AGATAGCAAATCGGCTGACG‐3ʹ, IL‐6: F‐5ʹ‐GTCCTTCCTACCCCAATTTCCA‐3ʹ; R‐5ʹ‐TAACGCACTAGGTTTGCCGA‐3ʹ,iNOS: F‐5ʹ‐CCAAGCCCTCACCTACTTCC‐3ʹ; R‐5ʹ‐CTCTGAGGGCTGACACAAGG‐3ʹ, MCP‐1: F‐5ʹ‐CCACTCACCTGCTGCTACTCA‐3ʹ; R‐5ʹ‐TGGTGATCCTCTTGTAGCTCTCC‐3ʹ,NRF: F‐5ʹ‐AGAAAGATGGGTTGGACT‐3ʹ; R‐5ʹ‐CTGTGTGGCTCTCGGA‐3ʹ, GAPDH: F‐5ʹ‐AGGAGCGAGACCCCACTAAC‐3ʹ; R‐5ʹ‐GATGACCCTTTTGGCTCCAC‐3ʹ. Relative mRNA levels were normalized to GAPDH level. For miRNA expression analysis, 150 ng total RNA was reverse‐transcribed into cDNA using miRNA‐specific primers supplied with TaqMan MicroRNA Reverse Transcription kit. The quantitative real‐time PCR was performed using the ABI Prism 7000 instrument (Applied Biosystems). Small nucleolar RNA 202 (Sno202) was used as an internal control for comparison of relative changes in miRNA.
3
Quantitative Real-Time PCR for Antioxidant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Trizol according to manufacturer instructions (Invitrogen, USA). Complementary DNA was synthesized by reverse transcription using a TaKaRa PrimeScript RT reagent kit and then subjected to quantitative real-time PCR using ABI 7900HT Real-Time PCR system (Applied Biosystems, USA). Each reaction was performed in triplicate. Primer sequences used in this experiment are as follows: ME1: 5'-CCTCACTACTGCTGAGGTTATAGC-3' and 5'-CGGTTCAGGATAAACTGTGGCTG-3'; TXNRD1: 5'-GCAATCCAGGCAGGAAGATTGCT-3' and 5'-CTCTTGACGGAATCGTCCATTCC-3'; GCLC: 5'-GTGGTACTGCTCACCAGAGTG-3' and 5'-AGCTCCGTGCTGTTCTGGGCCTT-3'; GCLM: 5'-ATCTTGCCTCCTGCTGTGTGATGC-3' and 5'-CAATGACCGAATACCGCAGTAGCC-3'.
4
Quantitative Analysis of Gene Expression in Liver and Colon Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Liver and colon tissues were homogenized in RNAiso Plus reagent. Centrifugation was performed after chloroform was added at 12,000 rpm for 15 min (4°C). The supernatant was collected and precipitated with isopropanol for 30 min at room temperature. Then the RNA pellet was obtained by centrifuging at 12,000 rpm for 10 min (4°C), and washed in 75% ethanol and then centrifuged at 7,500 rpm for 5 min (4°C). After resuspended in DEPC water, RNA was quantified with Nanodrop 2000 spectrophotometer (ThermoScientific, USA). The cDNA was synthesized with the PrimeScript RT reagent Kit and amplified using 7500 Real Time PCR System (Applied Biosystems, USA). Expression levels were calculated using the cycle threshold (CT) comparative method (2−ddCT) normalizing to Actin CT values. The primer sequence was shown in Supplementary Table 1 .
5
RNA Isolation and Real-Time PCR Protocol for Mouse Ovaries and Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from mouse ovaries, cultured human GCs, and cultured ovaries using a TRIzol reagent (Invitrogen, CA, USA). cDNA was synthesized using the PrimeScript RT Reagent Kit (Applied Biosystems, Takara, Japan) according to the manufacturer’s instruction, using 500 ng of total RNA per each sample. Real-time quantitative polymerase chain reactions (PCRs) were performed in triplicate using the SYBR Green Real-time PCR Master Mix (Applied Biosystems, Takara, Japan) with the Mastercycler ep realplex real-time PCR system (Eppendorf, Hamburg, Germany). The PCR primers were designed according to cDNA sequences in the National Center for Biotechnology Information database. Primer sequences are listed in supporting file (S1 Table ). Cycling conditions for the PCR system were as follows: 95°C for 5 min, and 60°C for 34 s for 40 cycles. The gene expression levels were evaluated using the ΔΔCT method, standardized to levels of β-actin amplification.
6
Quantification of CD164 and PTEN Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tissue samples and 5×106 U87 cells using TRIzol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. RNA concentrations were determined by spectrophotometry (DU-800; Beckman Coulter). A 260/280 absorbance ratio of 1.96 implied clean RNA at a concentration of 0.23 mg/ml. Total 1 µg RNA was reverse transcribed to cDNA using the PrimeScript RT Reagent kit (Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. qPCR was performed using the ABI 7300 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following amplification conditions: 30 sec at 98°C, 30 cycles of 10 sec at 98°C, 15 sec at 60°C, 15 sec at 72°C and 2 min at 72°C. The primer sequences were as follows: CD164, forward, 5′-TGAGCCCTGAACACCAGAGAG-3′, and reverse, 5′-AAAGCCAGATGAGCGCTTCTA-3′; phosphatase and tensin homolog (PTEN), forward, 5′-TCGTGGGTGCCTCGCT-3′, and reverse, 5′-CACCACTACAGCCAGCATTTTC-3′; GAPDH, forward, 5′-AACGGATTTGGTCGTATTGGG−3′, and reverse, 5′-TCGCTCCTGGAAGATGGTGAT-3′. The expression target genes in all samples was normalized to GAPDH. Following data collection, target gene expression was quantified by relative quantitative analysis using the 2-ΔΔCq method as described previously (19 (link)).
7
Quantifying Differential circRNA Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was performed to confirm the accuracy of the microarray data. Total RNA was treated with Rnase R (Epicentre, Inc.) and then converted to cDNA using a Prime Script RT Reagent Kit (Applied Biosystems, CA, USA). qRT-PCR was conducted by using the Power SYBR Green PCR Master Mix (Applied Biosystems, CA, USA) on the Applied Biosystems 7500 RT-PCR System (Applied Biosystems). The selected circRNAs were normalized to β-actin and the operations were repeated three times. The relative expression of the gene was analyzed by the 2-ΔΔCt method. The primers were listed in Table 2 .
Primers used for qRT- PCR
| Primer name | Sequence (5′–3′) | Tm (°C) | Lengths (bp) |
|---|---|---|---|
| β-actin | F:5’GTGGCCGAGGACTTTGATTG3’ R:5’CCTGTAACAACGCATCTCATATT3’ | 60 | 73 |
| circRNA_101147 | F:5’CCAAGACATATAGAGCAGTTCCAAG3’ R:5’ AATAGGCATGGCAACAGCTTC 3’ | 60 | 152 |
| circRNA_101561 | F:5’ ACCAGAGAAGAAAGGAGACTCAC 3’ R:5’ TGGATCAGCAGGGCATAAT 3’ | 60 | 118 |
| circRNA_101328 | F:5’ GGACGGCGTCACCAACCTA 3’ R:5’ GCACGCATTCTTTCTGGACAT 3’ | 60 | 150 |
| circRNA_104172 | F:5’ TCATCATCTTGAATTTAGTGAAGAG 3’ R:5’ CGATATTTCGTTTCTGCATTATT 3’ | 60 | 67 |
| circRNA_104640 | F:5’ TCTGTCCCACCCATCCCATCA 3’ R:5’ TCCAAAGAGCATCCCTGCAAAAG 3’ | 60 | 171 |
| circRNA_104642 | F:5’ ATGCAAAAGGAAATCTGATAAGA 3’ R:5’ CCTGGACCCATAAAAATAGTATG 3’ | 60 | 115 |
8
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following our previous steps (Zhou et al., 2013 (link)), total RNA from liver tissues and cells were isolated using RNAiso Plus following the manufacturer’s protocol. The cDNAs were produced with PrimeScript RT reagent kit and incubated at 37°C for 15 min and 85°C for 5 s. Real-time PCR reactions were done using a StepOne Plus device (Applied Biosystems) at 95°C for 10 s followed by 40 cycles of 95°C for 5 s and 60°C for 20 s according to instruction of the SYBR Premix Ex Taq kit. Data were analyzed by 2-ΔΔCt method. All primers were synthesized by TSINGKE (Wuhan, China). The sequences of all primers are listed in Table 1 .
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used for total RNA extraction. A miRNA purification kit was used for miRNA separation. Reverse transcription of cDNA was performed according to manufacturer instructions. Real-time PCR was performed using a PrimeScript RT reagent kit and detected by Applied Biosystems model 7900HT Fast Real-Time PCR System (Thermo Fisher, USA). The 2−△△Ct method was used for gene expression calculation [17 (link)].
10
Quantifying RNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from uterine tissues and cells using TRIzol (Invitrogen, USA). The PrimeScript RT Reagent Kit and the miRNA Reverse Transcription System TaqMan MicroRNA Assay were purchased from Applied Biosystems (Foster City, USA). Reverse transcription and quantification of total RNA and miRNA were performed as previously described [53 (link)]. Data were normalized to levels of U6 or GAPDH. All primers are shown in S-Tables 1– 3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!