Arsenic trioxide

LO2 human hepatocytes (Hu et al, 2013; Xu et al, 2019), liver cancer cells (HepG2, Huh‐1, JHH5 and JHH7; Ichimura et al, 2013), HeLa and MEFs (Tan et al, 2016) were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) in a 5% CO₂, humidified atmosphere at 37ºC. For generation of MOAP‐1 or p62 knockout cells using the CRISPR‐Cas9 system, the following gRNA sequences were cloned into the pX330‐U6‐Chimeric_BB‐CBh‐hSpCas9 expression vector (Cong et al, 2013): MOAP‐1 TGCGGAGACTAGTCACGCCC; p62/SQSTM1 AATGGCC‐ATGTCCTACGTGA. Cells were transiently transfected with the pX330 vectors. Three days post‐transfection, cells were single cell sorted by flow cytometry. Clones were expanded and screened for successful gene knockout of MOAP‐1 or p62 by Western blotting and validated by Sanger sequencing. At least two clones with successful gene KO were used in all experiments. For generation of stable cell lines, pIRES‐GFP/Myc‐MOAP‐1‐neomycin or pHTN‐Halo‐p62 expression vectors were transfected into the host cells, and 48 h later cells were selected with G418 antibiotics (500 µg/ml, Gibco) until stable pools were acquired. Treatment of cells with the proteasome inhibitor MG132 (Sigma‐Aldrich) or arsenic trioxide (Sigma‐Aldrich) to induce formation of p62 bodies were carried out as previously described (Eino et al, 2015; Pan et al, 2016).