Centro xs3 lb 960 luminometer

Manufactured by Berthold Technologies

Sourced in Germany, United States

The Centro XS3 LB 960 is a luminometer, a device used to measure luminescence. It is designed to perform quantitative analysis of light-emitting samples, such as those used in bioluminescence or chemiluminescence assays.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions) Dual luciferase reporter assay system, by Promega (4 mentions) Dual luciferase reporter assay system kit, by Promega (4 mentions) Passive lysis buffer (plb), by Promega (4 mentions) Dual luciferase assay system, by Promega (3 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (3 mentions) L 012, by Fujifilm (2 mentions) Horseradish peroxidase, by Merck Group (2 mentions) Dual luciferase reporter assay system, by Berthold Technologies (2 mentions) 96 well black flat bottom microplate, by Greiner (2 mentions) Pgl3 basic luciferase reporter plasmid, by Promega (2 mentions) Luciferase assay system, by Promega (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Phrg tk, by Promega (2 mentions) Dual luciferase reporter assay reagent, by Promega (2 mentions) Cd16 percp, by BD (1 mentions) Caspase glo 3 7 assay system, by Promega (1 mentions) Cd8 apc h7, by BD (1 mentions) Cd56 bv605, by BD (1 mentions) Tcrγδ fitc, by BD (1 mentions)

Spelling variants of this product

Centro LB 960 (150 citations) Centro XS3 LB 960 (105 citations) Centro LB 960 luminometer (96 citations) Centro XS3 LB 960 Microplate Luminometer (36 citations) LB 960 XS3 (9 citations) Centro XS3 luminometer (5 citations)

37 protocols using centro xs3 lb 960 luminometer

SARS-CoV-2 Variants Cytotoxicity Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vero E6 cells were infected with equal amounts (100 ng p24 Gag/well) of the most important variants of SARS-CoV-2 within clade 19B that were circulating in Spain at the time of the study: D614 and G614 [24 (link)]. Both pseudotyped viruses pNL4-3Δenv_SARS-CoV-2-SΔ19(G614)_Ren and pNL4-3Δenv_SARS-CoV-2-SΔ19(D614)_Ren were incubated with Vero E6 cells for 48 h. Then, Vero cells were co-cultured for 1 h with PBMCs isolated from the participants (ratio 1:10). Vero cells were detached with trypsin-EDTA solution (Sigma Aldrich-Merck, Darmstadt, Germany), and induction of cytotoxicity was measured using Caspase-Glo 3/7 Assay system (Promega) to evaluate the PBMCs-induced activation of caspace-3 in the monolayer. Viral infection in Vero E6 cells was also determined by measuring Renilla with Renilla Luciferase Assay kit (Promega) in Centro XS3 LB 960 luminometer (Berthold Technologies).
PBMCs were collected previous to detach the Vero E6 monolayer to evaluate the presence of the following cytotoxic cell populations: Natural Killer (NK) (CD3⁻CD56⁺CD16^±), NKT-like (CD3⁺CD56⁺), and TCRγδ (CD3⁻CD8^±TCRγδ⁺) cells by using specific conjugated antibodies: CD3-PE, CD8-APC H7, TCRγδ-FITC, CD56-BV605, and CD16-PercP (BD Biosciences). Analyses were performed using a BD LSRFortessa X-20 flow cytometer and FlowJo software version 10.7.1 (Tree Star Inc.).

Rodríguez-Mora S., Pérez-Lamas L., Sainero M.S., Torres M., Sánchez-Menéndez C., Corona M., Mateos E., Casado-Fernández G., Alcamí J., García-Pérez J., Pérez-Olmeda M., Murciano-Antón M.A., López-Jiménez J., García-Gutiérrez V, & Coiras M. (2023). Persistent Immunity against SARS-CoV-2 in Individuals with Oncohematological Diseases Who Underwent Autologous or Allogeneic Stem Cell Transplantation after Vaccination. Cancers, 15(8), 2344.

+ Open protocol

+ Expand

Gaussia Luciferase Activity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gaussia luciferase activity was measured by adding 20 μL of harvested cell culture supernatant per well on a 96-well LUMITRAC 600 plate, followed by the addition of Coelenterazine substrate and the detection of luminescence using a Centro XS³ LB 960 luminometer (Berthold Technologies). The microplate reader was set to dispense 50 μL of substrate, followed by shaking for 2 s and reading for 5 s. Samples were assayed in triplicate and read sequentially.

Praditya D.F., Klöhn M., Brüggemann Y., Brown L.E., Porco JA J.r., Zhang W., Kinast V., Kirschning A., Vondran F.W., Todt D, & Steinmann E. (2022). Identification of structurally re-engineered rocaglates as inhibitors against Hepatitis E virus replication. Antiviral research, 204, 105359.

+ Open protocol

+ Expand

Quantifying VSV-luciferase Replication in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Replication of VSV-luciferase within the cells in vitro was determined by measuring the firefly luciferase activity in the cell lysates as described before (32 (link)). Briefly, following corresponding time points of infection, BM-derived cells were lysed in 35 μl of 1x Passive lysis buffer (Promega) and frozen down at −20°C overnight. Twenty microliters of cell lysate/sample was transferred into white 96-well plate. Assay buffer (25 mM glycylglycine, 15 mM MgSO4, 4 mM EGTA, 15 mM KPO4 pH 7.8, 1 mM DTT, 2 mM ATP) and substrate luciferin solution (25 mM glycylglycine and 200 μM luciferin, pH 8.0) were prepared in distilled water. Firefly luciferase activity was assessed for 1 s using a plate luminometer (Berthold Centro XS3 LB960 luminometer), with automatic injection of 72 μl of assay buffer and 40 μl of substrate per well. Measured relative light units (RLU) were plotted as a quantification of VSV replication in target cells.

Solmaz G., Puttur F., Francozo M., Lindenberg M., Guderian M., Swallow M., Duhan V., Khairnar V., Kalinke U., Ludewig B., Clausen B.E., Wagner H., Lang K.S, & Sparwasser T.D. (2019). TLR7 Controls VSV Replication in CD169+ SCS Macrophages and Associated Viral Neuroinvasion. Frontiers in Immunology, 10, 466.

+ Open protocol

+ Expand

Evaluating PLOD2 Promoter Activity in IL-6 Stimulated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ca9-22 cells were cultured in 24-well plates (1×10 cells/well) for 24 h. The following day, cells were co-transfected with the Firefly luciferase reporter plasmid containing a PLOD2 promoter (250 ng) and the control reporter vector expressing Renilla luciferase (pRL-TK, 25 ng; Promega Corporation) as an internal control for normalization of Firefly luciferase activity in comparison with Renilla luciferase activity. Transfections were performed using Lipofectamine^® 3000 reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After 16 h of transfection, 0.5 ng/ml recombinant human IL-6 (cat. no. 206-IL-010; R&D Systems, Inc.) was added to the medium, and cells were cultured at 37°C for 24 h. Luciferase activity was measured with the Dual-Luciferase Reporter Assay System (Promega Corporation), according to the manufacturer's protocol. The luminescence was detected with a Centro XS3 LB 960 luminometer (Titertek-Berthold).

Saito K., Mitsui A., Sumardika I.W., Yokoyama Y., Sakaguchi M, & Kondo E. (2021). PLOD2-driven IL-6/STAT3 signaling promotes the invasion and metastasis of oral squamous cell carcinoma via activation of integrin β1. International Journal of Oncology, 58(6), 29.

+ Open protocol

+ Expand

Transfection and Luciferase Assay in HEK-293F

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK-293F cells were grown in suspension and transfected with ExpiFectamine 293 reagent (ThermoFisher, Waltham, MA, USA) according to the manufacturer’s recommendations. Briefly, a total of 75.10⁶ cells were harvested and the pellet was resuspended in 25 mL of Expi293 Expression medium before incubation at 37 °C for 30 min. Twenty-five micrograms of each plasmid were diluted in 1.5 mL of Opti-MEM medium and mixed with ExpiFectamine reagent before incubation at room temperature for 20 min. Finally, the mixed ExpiFectamine/plasmid was added to the cells and further incubated at 37 °C under agitation for 4 days. ExpiFectamine Transfection enhancers were added on day 1 post-transfection. Recombinant proteins were harvested directly from the culture supernatant at day 4 post-transfection. Luciferase activity was quantified onto a Centro XS3 LB 960 luminometer (Berthold Technologies, Thoiry, France) by adding 100 µL of NanoGlo reagent (Promega, Madison, WI, USA) to tenfold dilutions of supernatant.

Bratuleanu B.E., Raileanu C., Chrétien D., Guardado-Calvo P., Bigot T., Savuta G., Temmam S, & Eloit M. (2023). A Search for Tick-Associated, Bronnoya-like Virus Spillover into Sheep. Microorganisms, 11(1), 209.

+ Open protocol

+ Expand

Evaluating Transcriptional Activity of HNF1A Variants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transcriptional activity was evaluated as previously described.⁴⁷ Briefly, the c.1108G>T p.(V370F) variant was introduced into the human HNF1A WT cDNA isoform A (NM_000545.6), harbouring the variants c.51C>G, L17, and c.79A>C, I27L, in the pcDNA3.1/HisC vector using the QuikChange II XL Site Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA). Transcriptional activity was measured on cell lysates from HeLa cells transiently transfected with a rat albumin promoter-linked Firefly Luciferase reporter plasmid (pGL3-RA) along with either variants c.1108G>T p.(V370F), P112L,⁴⁸ (link) P447L,⁴⁸ (link) E508K,² (link)^,⁴⁹ (link) or wildtype (WT) HNF1A plasmid. Renilla Luciferase reporter pRL-SV40 was used as an internal control. Luciferase activity was measured 24-h post-transfection using the Dual-Luciferase Assay System (Promega, Madison, WI) on a Centro XS3 LB 960 luminometer (Berthold Technologies, Germany). The same cell lysates were used to measure HNF1A protein abundance by SDS-PAGE and immunoblotting (anti-HNF1A from Cell Signaling Technologies, Beverly, MA), normalised against alpha-tubulin-HRP (Abcam, Cambridge, MA). Transcriptional activity and protein expression experiments were performed in triplicate and duplicate respectively, and repeated on three individual days (n = 3).

Thuesen A.C., Stæger F.F., Kaci A., Solheim M.H., Aukrust I., Jørsboe E., Santander C.G., Andersen M.K., Li Z., Gilly A., Stinson S.E., Gjesing A.P., Bjerregaard P., Pedersen M.L., Larsen C.V., Grarup N., Jørgensen M.E., Zeggini E., Bjørkhaug L., Njølstad P.R., Albrechtsen A., Moltke I, & Hansen T. (2022). A novel splice-affecting HNF1A variant with large population impact on diabetes in Greenland. The Lancet Regional Health - Europe, 24, 100529.

+ Open protocol

+ Expand

Transactivation Assay for HNF1A Variants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were cultured and transiently transfected with wild-type or variant HNF1A cDNA, together with the firefly reporter plasmid and the Renilla reporter (pRLSV40) as an internal control. Luciferase activity was measured 24 h post transfection using the Dual-Luciferase Assay System (Promega) on a Centro XS3 LB 960 luminometer (Berthold Technologies, Germany). Next, the level of HNF1A protein expression in the wild-type and variants was assessed in cell lysates obtained for the transactivation assays. In short, 20 µl of cell lysates was subjected to SDS-PAGE and immunoblotting using antibodies against HNF1A (Cell Signaling, Beverly, MA, USA) and α-tubulin (Abcam, Cambridge, MA, USA), with α-tubulin as a loading control. For the five pathogenic variants, these variants have been comprehensively investigated previously [25 (link), 26 (link), 29 (link), 30 (link)] and thus only the luciferase assay was reinvestigated.

Svalastoga P., Kaci A., Molnes J., Solheim M.H., Johansson B.B., Krogvold L., Skrivarhaug T., Valen E., Johansson S., Molven A., Sagen J.V., Søfteland E., Bjørkhaug L., Tjora E., Aukrust I, & Njølstad P.R. (2023). Characterisation of HNF1A variants in paediatric diabetes in Norway using functional and clinical investigations to unmask phenotype and monogenic diabetes. Diabetologia, 66(12), 2226-2237.

+ Open protocol

+ Expand

Analyzing Rice Cell Responses to Oligosaccharides

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rice-suspension cells were used for ROS burst and MAPK assays. The cells were used 3–4 days after subcultivation in a fresh medium. The ROS burst and MAPK assays were described previously^{33 (link)}. Briefly, aliquots of 500 mg cells were suspended in 5 ml pre-incubation medium (3% sucrose and 10 mM MES in 5% culture medium, pH 5.8) and incubated under culture conditions for 4–5 h. Before the assay, the medium was replaced with 200 μl fresh medium containing 20 μM L-012 (Wako Chemicals), 10 mg ml⁻¹ horseradish peroxidase (Sigma), and respective elicitors. The luminescence was recorded by a Centro XS3 LB 960 Luminometer (Berthold Technologies). Phospho-MPK3/6 signals were detected by a phosphorylation-specific p38 MAPK antibody (Cell Signaling, 1:5000 dilution). The highly purified oligosaccharides (CTE, CTR, BGTRIA, BGTRIB, BGTETB, BGTETC, LAM3, and XTR) used for ROS burst and MAPK activation assays were obtained from Megazyme (Ireland).

Yang C., Liu R., Pang J., Ren B., Zhou H., Wang G., Wang E, & Liu J. (2021). Poaceae-specific cell wall-derived oligosaccharides activate plant immunity via OsCERK1 during Magnaporthe oryzae infection in rice. Nature Communications, 12, 2178.

+ Open protocol

+ Expand

Regulation of IGF1 Promoter by miR130b

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cDNA from HEK‐293T cells was used to amplify the promoter region (−674 to −667 bp) of IGF1, forward primer: 5′‐ATCTG TTCCGCGTGGATGAAGGGAGACAGCAGACATCTGAATG‐3′; reverse primer: 5′‐TCACGATGCGGCCGCTCGAGTATTCACAGGCAAAGTAGTCCTTCAAG‐3′. The BamHI and XhoI restriction enzyme sites were used. HEK‐293T cells were seeded in 24‐well plates and co‐transfected with 100 nm of miR130b mimics, 100 ng·mL⁻¹ promoter region (−674 to −667 bp) luciferase reporter construct, and 10 ng·mL⁻¹ luciferase reporter using lipofectamine 2000. Cells were collected 24 h after transfection, using the Passive Lysis Buffer (30 μL per well) provided as part of the Dual‐Luciferase Reporter Assay System Kit (Promega, Madison, WI, USA). Firefly and Renilla luciferase activities were examined by the Dual‐Luciferase Reporter Assay System and detected by a Centro XS3 LB960 Luminometer (Berthold, Oak Ridge, TN, USA).

Sun R., Zheng Z., Wang L., Cheng S., Shi Q., Qu B., Fu D., Leboeuf C., Zhao Y., Ye J., Janin A, & Zhao W. (2020). A novel prognostic model based on four circulating miRNA in diffuse large B‐cell lymphoma: implications for the roles of MDSC and Th17 cells in lymphoma progression. Molecular Oncology, 15(1), 246-261.

+ Open protocol

+ Expand

Transcriptional Regulation via P50 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK-293T cells were transfected with luciferase reporter and P50 overexpressing vector, using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Protein was collected 24 h after transfection, using the Passive Lysis Buffer (30 μL per well) provided as part of the Dual-Luciferase Reporter Assay System kit (Promega). Firefly and Renilla luciferase activities were examined by the Dual-Luciferase Reporter Assay System and detected by a Centro XS3 LB960 Luminometer (Berthold).

Zheng Z., Cheng S., Wu W., Wang L., Zhao Y., Shen Y., Janin A, & Zhao W.L. (2014). c-FLIP is involved in tumor progression of peripheral T-cell lymphoma and targeted by histone deacetylase inhibitors. Journal of Hematology & Oncology, 7, 88.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!