Sensimix sybr hi rox kit

RNA from HIO monolayers and human PBMCs were isolated with the RNeasy Plus Micro kit (74034, Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The RNA concentration of the samples was determined using the NanoDrop™ 1000 Spectrophotometer. Subsequently, cDNA was synthesized with the SensiFAST™ cDNA Synthesis Kit (BIO-65053, Meridian Bioscience, Cincinnati, OH, USA). Quantitative real-time PCR was performed on the LifeCycler^® 480 qPCR machine (Roche Molecular Systems, Inc.) with a three-step program for 40 cycles and SensiMix SYBR Hi-ROX Kit (QT605-05, Meridian Bioscience, Cincinnati, OH, USA) was used for cDNA amplification. 5 ng cDNA was used per reaction with a primer concentration of 250 nM (both for forward and reverse primer). Primer sequences were derived from PrimerBank [44 (link)].
An overview of the primers that were used is presented in Table 1. RT-qPCR data were analyzed using LinRegPCR software (version 2016.0, Heart Failure Research Center, Amsterdam University Medical Center, Amsterdam, The Netherlands). The geometric mean of the three housekeeping genes (beta-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and 14-3-3 protein zeta/delta (YWHAZ) for HIO monolayer experiments and CD3 epsilon (CD3e), GAPDH and YWHAZ for PBMC experiments) was used for data normalization.

Total RNAs were extracted with TRIzol reagent (Thermo) and the cDNAs were prepared using the SuperScript III Reverse Transcriptase (Thermo), dNTP (Genedirex, Las Vegas City, NV, USA), and random primers (Thermo). The amount of cDNA was detected with SensiMix™ SYBR® Hi-ROX Kit (Bioline, Taunton, MA, USA) and primers (listed in Table S3) with ABI StepOnePlus Real-Time PCR System (Thermo). All data were triplicated, and normalized to GAPDH.

Lungs were placed in RNA later (QIAGEN, USA) immediately after sacrifice, kept for one night at 4 °C and then frozen at -80 °C until total RNA extraction. Total RNA extraction was performed according QIAGEN RNeasy mini spin columns method, starting with 30 mg of tissue. Total RNA (2 μg) was reversely transcribed into cDNA using random hexamer primers and SuperScript IV (Invitrogen, USA). The resulting one-stranded cDNA was diluted 1:2 and 1 μl used for PCR reactions. Amplification of Muc5b and Muc5ac was performed using the SensiMix SYBR Hi-ROX Kit (Bioline, UK) using a RotorGene 6000 Series equipment (Corbett Research, Canada). Primer sets used for amplification were: Muc5b F: 5′ CCTGAAGTCTTCCCCAGCAG 3′; Muc5b R: 5′ GCATAGAATTGGCAGCCAGC 3′; Muc5ac F 5′ ACCACGGATATCAGAACCAGC 3′; Muc5ac R 5′ TGTCAAGCCACTTGGTCCAG 3′. PCR reactions were performed with the following conditions: Initial denaturation of 5 minutes at 94 °C, 45 cycles of 30 seconds at 94 °C, 20 seconds at 60 °C, 20 seconds at 72 °C. Actin was used as internal amplification control^{26 (link)}. mRNA quantifications were normalized by actin. Results were compared using the corresponding control determination at each sacrifice point as the reference value.

LCLs were resuspended in TRI reagent® (Molecular Research Center, Inc.), mixed with 1/5 volume of chloroform, incubated for 3 min at room temperature and spun down at 12,000 × g. The transparent phase was separated and the RNA was precipitated with isopropanol and washed once with 75% ethanol. The RNA pellet was further air-dried and dissolved in H₂O-DEPEC. Subsequently, cDNA was generated with the SuperScript® III Reverse Transcriptase (Technologies) according to the manufacturers protocol. Quantitative PCR (qPCR) was performed with a Rotor Gene RG3000A, Corbett Research using gene specific primer and the SensiMix™ SYBR® Hi-ROX Kit (Bioline). qPCR was performed with following oligonucleotides (Microsynth): Polλ(fwd)5′-CCTGTGCCCTGCTCTACTTC-3′ and Polλ(rev)5′-CTCAGCAGGTTCTCGGTAGG-3′; Cdc6(fwd)5′-GGGAATCAGAGGCTCAGAAG-3′ and Cdc6(rev)5′-CACTGGATGTTTGCAGGAGA-3′; L28(fwd)5′-GCAATTCCTTCCGCTACAAC-3′ and L28(rev)5′-TGTTCTTGCGGATCATGTGT-3′. Results were normalized against L28 expression.

The transcript levels of FcLDP1 in different stages of fruit development, and after hormone treatments were determined by RT-qPCR, based on the protocol described in Aguayo et al. (2013) (link). Specific primers were designed with the Primer 3 software⁴ (Supplementary Table S1). Analysis by RT-qPCR was carried out using 10 μL SensiMix SYBR Hi-ROX kit (Bioline), with 5 μM of each primer, in a Stratagene MX3000P (Agilent Technologies) with the following parameters: 95°C for 10 min, then 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 20 s. FvGAPDH (Pimentel et al., 2010 (link)) and FcRIB314 (Amil-Ruiz et al., 2013 (link)) were used as constitutively expressed control genes. The specificity of the amplification products was confirmed by registration of the melting curve of the PCR products, a heat dissociation protocol (from 55 to 95°C) and visualization in 3% agarose gels. The Ct values obtained (threshold cycle value) were analyzed by averaging the three biological replicas and two technical replicas of each sample (Livak and Schmittgen, 2001 (link)).

For microbiota analysis, samples were collected on chow and after treatment with GW501516 or HFD. The middle and distal third of the small intestine, cecum and colon including content was removed and homogenized in lysis buffer. Bacterial DNA from the homogenate was isolated using the QIAamp DNA Stool Mini Kit (Qiagen, Valencia, CA), quantified by spectrophotometry and 50 ng (15 ng respectively for universal bacterial primer) of DNA was amplified by RT-PCR using the SensiMix™ SYBR® Hi-ROX Kit (Bioline, Taunton, MA) and bacterial group-specific primers for 16S as previously described^{47 (link)}.