Pcmv6 xl5 vector

APOL1 cDNA corresponding to splice variant A (NM_003661) was obtained in pCMV6-XL5 vector (OriGene). The open reading frame of APOL1 genes expressed from pCMV6-XL5 was modified by PCR with myc epitope^{24 (link)}. APOL1 deletion mutants were created using the QuickChange II site-directed mutagenesis kit (Stratagene). APOL1 variant C (NM_001136541) was generated by deletion of 54 nucleotides corresponding to the full exon 4 of APOL1 variant A using a set of two complementary primers: 5′-GAGTCTCTGTC CTCTGCATCTGGGTGCAACAAAACGTTCCAAGTGGG-3′ and 5′-CCCACTTGGAACGTTTTG TTGCACCCAGATGCAGAGGACAGAGACTC-3′. Integrity of APOL1 constructs was confirmed by DNA sequencing.

iPSC cardiomyocytes at day 6 post initial plating were transfected with 100 ng plasmid DNA using ViaFect transfection reagent (E4981, Promega) and the following human DYRK1A and SRSF6 expression constructs: DYRK1A human clone (NM_001396, SC314641, Origene), DYRK1A human tagged ORF Clone (NM_001396, RG212584, Origene), and SRSF6 cDNA ORF clone N-HA tag (HG19052-NY, Sinobiological). Control cultures were transfected with ~ 100 ng of empty PCMV6XL5 vector (Origene).
Drug treatments were initiated 24 h post-transfection with expression constructs. Daunorubicin (DAU, 14159, Cayman Chemical) and epigallocatechin gallate (EGCG, 709035, Cayman Chemical) were added to culture media for a total incubation time of 14 h. DMSO vehicle was added to controls. After treatments with DAU, iPSC cardiomyocytes were washed with PBS, and incubated in fresh culture medium, or medium supplemented with EGCG for 24 h. Cell viability was determined with the CellTiter-Glo luminescent viability kit (G7570, Promega).

Mutagenesis of vimentin (pCMV6-XL5 vector; Origene) was conducted with the QuikChange II Site-Directed Mutagenesis Kit (Aligent Technologies) to generate the following point mutations: S409A, S409D, S409E, S412A, S412D, and S412E. Sanger sequencing for the entire vimentin coding sequence was completed to verify that the point mutations were present in the sequence without off-target changes. For transfection experiments for immunofluorescence imaging, SW13 Vim⁻ cells were seeded onto 4-well chamber slides and transfected with vimentin wild-type and mutant plasmids along with lipofectamine 2000 that was utilized in accordance with product instructions (Thermo Fisher Scientific). Media was changed 6 h after transfection, and cells were fixed at the 24-h timepoint (see below for details on immunofluorescence staining procedures). For biochemical transfection and hypotonic stress experiments, BHK-21 cells were plated on 6-well plates and transfected with vimentin wild-type and mutant plasmids plus lipofectamine 2000. Media was changed 6 h after transfection, and cells were treated with sterile molecular grade water at the 24-h timepoint. The cells were treated with hypotonic stress for 4 min in a 37°C incubator, then harvested and separated into TCL, detergent-soluble, and detergent-insoluble fractions as described above.

We used constructs for the human Btg2 gene cloned into the pCMV6-XL5 vector (SC115914, Origene) and also pCAGGS-GFP [35 (link)] for gain-of-function experiments. p21 gene silencing was performed by electroporation of a short hairpin RNAi (sh-p21), cloned into the pcU6-1-shRNAi (a generous gift of Dr Tim J Doran) as described by [36 (link)]. The efficiency of electroporations was confirmed using QPCR and immunohistochemistry.
For in vitro experiments, cells were electroporated using the Eppendorf Multiporator system (Eppendorf) following the manufacturer's instructions. Control nucleofections using the empty vector were performed in all experiments.
For in vivo experiments, the limb bud was electroporated at day 2 of incubation (stage 13 HH) with a mix of 0.1% Fast Green (Sigma®), 1 μg/μl pCAGGS-GFP, and 8 μg/μl of hBtg2- pCMV6-XL5 according to the Gros and Tabin procedure [37 (link)]. Limbs electroporated with pCAGGS-GFP alone developed normally and were used as controls. Identification of GFP labeling was used to assess the spatial distribution of electroporated cells in vivo.
The gross morphology of limbs overexpressing Btg2/GFP was examined in paraffin wax or vibratome sections. These sections were also used for TUNEL and β-galactosidase activity assays, and p-H3 immunolabeling, to detect cell death, cell senescence and cell proliferation respectively.

After 2 days of transfecting HPASMC with either PCMV6-XL5-BMPR2 plasmid or empty PCMV6-XL5 vector (Origene Technologies, Inc., Rockville, MD) as described previously^{15 (link)}, cells were serum starved for 48 h followed by cocaine and Tat treatment. Cells were lysed after 2 days and assayed for p-MKK3/6, p-p38MAPK, p-MKK4 and p-JNK expression by western blot.

FLAG-tagged PITX1 expression plasmids were as described previously [29 (link)]. pFLAG-ZCCHC10 was constructed by amplification of ZCCHC10 cDNA from IMR90 cDNA by PCR using KOD plus DNA polymerase (TOYOBO, Osaka, Japan) and the following primer sequences; forward primer: 5'- GAAGATCTTATGGCGACTCCCATGCATCGGCTAA, reverse primer: 5'- GGGGTACCCTATTTCTTTTTCTTCTTCTTTGGT. Sequences were inserted into the BglⅡ/Acc65I (TOYOBO) digested FLAG-tagged vector pCMV-FLAG4 (Sigma). pCMV-FLAG4 was used as a control.
Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA) or pEBMulti-Bsd vector (Wako, Tokyo, Japan). PITX1 ΔHD1, ΔHD2, ΔOAR and ZCCHC10 ΔCCHC expression plasmids were established using a mutagenesis kit (TOYOBO), according to the manufacturer's instructions. The following primer sequences were used; PITX1 ΔHD1 forward primer: 5'-CGCGAGCGTAACCAGCAGCTGGAC, reverse primer: 5'-GCTCATGTCGGGGTAGCGGTTCCT, PITX1 ΔHD2 forward primer: 5'- ATGAGGGAGGAGATCGCCGTGTGG, reverse primer: 5'- CTGCTTCTTCTTCTTGGCTGGGTC, PITX1 ΔOAR forward primer: 5'- TTTGGCTACGGCGGCCTGCAGGGC, reverse primer: 5'- GTAGACGCTGTAGGGCGAGGCGGG, ZCCHC10 ΔCCHC forward primer: 5'- ACAGGAAAAAGAAAATACCTACAT, reverse primer: 5'- TCTTACATGTTGCTTATTTGCTTC.