Dual luciferase report assay system

The pGL3-MHC-II (1 μg) and pGL3-CIITA (1 μg) plasmids (Shenggong, Beijing, China) were transferred into HEK-293T cells, with or without Tim-3 plasmid, and cultured for 48 h. The luminescence was detected with the Dual-Luciferase Report Assay System (Promega, E1910). Briefly, the cells were washed with PBS once and 200 μl lysis buffer was added, then 20 μl was added to a 96-well plate, 50 μl 1× Gold’s reagent was added to each well, and firefly luciferin was measured immediately, and then 50 μl 1× Stop reagent was added to measure Renilla luciferase. Finally, the relative of firefly fluorescein/renilla fluorescein was calculated (33 (link)).

Complementary oligonucleotides containing the wild-type or a mutated sequence of the Nexmif 3′UTR were subcloned into the psiCHECK-2 vector using XhoI and NotI restriction sites. KLA wt/wt and mut/mut cells pretreated with adCre (48 hours) were seeded in a 24-well plate. Cells were transfected with 0.5 μg of plasmids using the X-tremeGENE HP DNA Transfection Reagent (6366244001, Roche) for 72 hours. Media were refreshed for 24 hours and Renilla and firefly luciferase activities were measured using the Dual Luciferase Report Assay System (Promega) following the manufacturers’ instructions and a plate reader (Berthold). Wild-type 3′UTR primers (5′–3′): Forward aagttctcgaggctgcctacagagttttgaatgtacttactagactttagttagagaccctttttatgaatgtaacctgtttctgtttgtttaaatatttgtgactgaatgtatggtgaaactgtcatgcggccgcttgaa; Reverse ttcaagcggccgcatgacagtttcaccatacattcagtcacaaatatttaaacaaacagaaacaggttacattcataaaaagggtctctaactaaagtctagtaagtacattcaaaactctgtaggcagcctcgagaactt. Mutated 3′UTR primers (5′–3′): Forward aagttctcgaggctgcctacagagtttggggggacttactagactttagttagagaccctttttaggggggaacctgtttctgtttgtttaaatatttgtgacggggggatggtgaaactgtcatgcggccgcttgaa; Reverse ttcaagcggccgcatgacagtttcaccatccccccgtcacaaatatttaaacaaacagaaacaggttcccccctaaaaagggtctctaactaaagtctagtaagtccccccaaactctgtaggcagcctcgagaactt.

The target sites of EGR1 and miR-130a were determined by bioinformatics websites miRanda, starBase and DIANA. EGR1 3’untranslated region (UTR)-wild-type (WT) and EGR1 3’UTR-mutant type (MUT) fragments were composed by Sangon with Not and Xho endonuclease cleavage sites at both ends, then recombined into the psi-CHECK2 polyclone sites. The WT and MUT sequences were identified. HCCLM3 cells were seeded into a 24-well plate. With 80% confluence, cells were transfected. The transfection reagent was arranged according to Lipofectamine^TM 2000 specification(Invitrogen Inc., Carlsbad, CA, USA). The dual-luciferase reporter vectors (50 ng) and miR-130a mimic or mimic NC (50 nmol/L) were co-transfected into HCCLM3 cells. The luciferase activity was verified by Dual-luciferase Report Assay System (Promega, Madison, WI, USA) 48 h later.

For luciferase assays, the amounts of plasmid DNAs used for trasfections of HEK293 cells were: 20 ng of the Wnt reporter Top Flash, 2 ng of the control Renilla reporter, 150 ng Wnt2, 75 ng Fzd9, and 150 ng shFzd9 per well of a 24-well plate. When required, empty pCS2+ or FUXH1Off-EGFP plasmids were added in a sufficient amount to reach 0.4 μg of total plasmid DNA per well. After 48 h, cells were lysed and the activity of the Topflash and Renilla reporter genes was measured using the Dual Luciferase Report Assay System (Promega, Madison, WI, USA) according to the indications of the manufacturer. Data are expressed as the Topflash: Renilla ratio, relative to the basal background activity obtained from cells transfected with control plasmids.

Cells were seeded in 6-well plates for 18 h and then transfected using Lipofectamine 2000 reagent with 0.5 µg plasmid each (0.05 µg Renilla DNA was used for normalization). Cells were then treated with or without 10 ng/mL IFN-γ. 24 h later, relative luciferase units (RLUs) were measured using the Dual-Luciferase Report Assay System and GloMax 96 Microplate Luminometer (Promega) according to the manufacturer's instructions. RLUs from firefly luciferase signal were normalized by RLUs from Renilla signal.