Although following a well-established protocol (Shokoples et al., 2009 (link)) for multiplex species-specific qPCR, a subset of samples were verified in singleplex reactions adopted to detect only P. falciparum in order to exclude probable inter-species cross-binding of primers. In addition, a randomly selected subset of blood samples (n = 20), blinded to previous results and sample identity, were re-analyzed (from DNA extraction to PCR) by a second researcher in our laboratory. In addition, the same subgroup of samples was analyzed by the Department of Clinical Microbiology at Karolinska University Hospital, serving as reference laboratory for malaria PCR in Sweden. DNA was extracted from whole blood using the Universal Pathogen protocol on MagNA Pure 96 system (Roche diagnostics). Real-time PCR was performed following a modified protocol of Shokoples et al. (2009) (link) and Divis et al. (2010) (link) on a QuanStudio™ 6 Flex Real-Time PCR System (Applied Biosystems).
Quanstudio 6 flex real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The QuanStudio™ 6 Flex Real-Time PCR System is a laboratory instrument designed for precise and accurate quantitative real-time PCR analysis. It features a modular design with up to six independent sample blocks, allowing for flexible and efficient experimentation.
Automatically generated - may contain errors
Lab products found in correlation
Magna pure 96 system, by Roche (1 mentions)
Sybr green real time pcr kit, by Takara Bio (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Sybr premix ex taq 2 reagent, by Takara Bio (1 mentions)
Primerscript pcr kit, by Takara Bio (1 mentions)
Stool dna kit, by Omega Bio-Tek (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Takara taq dna polymerase, by Takara Bio (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sanger sequencing, by Tsingke (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Ecorv, by Thermo Fisher Scientific (1 mentions)
Hotstartaq dna polymerase, by Qiagen (1 mentions)
6 protocols using quanstudio 6 flex real time pcr system
1
Malaria Species-Specific qPCR Protocol
2
Quantifying HIV-1 Reverse Transcription and Nuclear Import
3
Quantifying Bacterial Diversity in Colonic Digesta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA in colonic digesta was extracted by using the Stool DNA Kit (Omega Bio-Tek, Doraville, CA, USA). All primers and probes were listed in Table 4 and designed following the previous report [25 (link)]. Microbial real-time quantitative PCR was performed in a QuanStudio™ 6 Flex Real-Time PCR System (Applied Biosystems, Foster, CA, USA). Briefly, the total bacteria was detected using SYBR® Premix Ex Taq™ II reagent (TaKaRa, Dalian, China), and the Bacillus, Lactobacillus, E. coli and Bifidobacterium were detected using PrimerScriptTM PCR kit (TaKaRa, Dalian, China) following the previous methods [26 (link)]. Furthermore, for the quantification of bacteria, specific standard curves were generated by constructing standard plasmids as presented by Chen et al. (2013) [26 (link)].
4
Quantitative Real-Time PCR of Jejunal Mucosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 40 mg of jejunal mucosa were used for total RNA extraction using TRizol Reagent (TaKaRa, Dalian, China). Reverse transcription was performed according to the instructions of the PrimeScriptTM RT reagent kit (TaKaRa, Dalian, China). Real-time PCR was conducted in a QuanStudio™ 6 Flex Real-Time PCR System (Applied Biosystems, Foster, CA, USA), using SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China). The primer sequences were listed in Table 3 and purchased form TaKaRa (Dalian, China). The real-time PCR cycling conditions were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The relative mRNA levels of target genes were calculated using the 2−ΔΔCt method with β-actin as the housekeeping gene [24 (link)].
5
Confirming SARS-CoV-2 Detection Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the results of the SARS-CoV-2 MS method, RNA extracted from 324 clinical samples and 3 clinical isolates was simultaneously analysed by the MS and RT-qPCR methods. A total of 327 samples were performed in QuanStudioTM 6 Flex Real-time PCR system (Thermo Fisher Scientific Inc., Waltham, USA) using a Novel Coronavirus Nucleic Acid Detection Kit (Biogerm, Shanghai, China), and then viral RNA was analysed using the quantitative standard curve.
To further verify the positive results of the MS method, viral RNA of 327 samples was reverse transcribed into cDNA using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) and then amplified using Takara Taq DNA Polymerase (Takara, Kyoto, Japan). The amplification products were analysed by Sanger sequencing (Tsingke Biotechnology Co., Ltd., Beijing, China). Primer pairs used for Sanger sequencing are shown in SupplementaryTable S1 .
To further verify the positive results of the MS method, viral RNA of 327 samples was reverse transcribed into cDNA using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) and then amplified using Takara Taq DNA Polymerase (Takara, Kyoto, Japan). The amplification products were analysed by Sanger sequencing (Tsingke Biotechnology Co., Ltd., Beijing, China). Primer pairs used for Sanger sequencing are shown in Supplementary
6
Sensitive DNA Double-Strand Break Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IRS-EDSB-LM-PCR or DNA-GAP PCR was performed as previously described33 (link). HMWDNA was used for DNA-GAP PCR to identify EDSBs in cells using a QuanStudioTM 6 Flex Real-Time PCR system (Thermo Fisher Scientific, MA, USA). The following components were included in the PCR mix: 1× TaqmanTM Universal PCR Master mix (Applied Biosystems, CA, USA), 0.5 U HotStarTaq DNA polymerase (Qiagen, Hilden, Germany), 0.3 µM probe homologous to the 3′-linker sequence (6-fam) ACGTCCACGAGGTAAGCTTCCGAGCGA (tamra) (phosphate), 0.5 µM IRS primer (LINE-1) (5'-CTCCCAGCGTGAGCGAC-3'). EcoRV and AluI (Thermo Fisher Scientific, MA, USA) were used to digest the control DNA, which was then ligated with linkers. The following were the PCR cycle conditions: 1 cycle of 50 °C for 2 min followed by 95 °C for 10 min and 60 cycles of 95 °C for 15 s and then 60 °C for 2 min. The amount of DNA-GAP PCR in each reaction was compared to the ligated control digested DNA and reported as a percentage of EcoRV and AluI-digested genome DNA-GAP PCR amplicons (%DNA-GAP PCR of control DNA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!