Pacbio sequel sequencer

To specifically amplify molecular bridges containing both a clonal tracking barcode and a cell barcode, we performed PCR using the single-cell cDNA library as the template and a single primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT). The PCR products were more than 1.5 kb long and were purified from an agarose gel (Zymo Research) before sequencing with the PacBio Sequel sequencer (Pacific Biosciences, v2.1). Raw PacBio sequencing data were analyzed using the circular consensus sequences application of SMRT Analysis software (Pacific Biosciences, SMRT Link Version 5.1.0) with default parameters. Mapping between single-cell gene expression and the clonal activity was established based on the PacBio reads of at least one molecule that contained the exact match to a clonal tracking barcode and a cellular cDNA index. No misread was allowed in this mapping. Cellular cDNA indexes that were mapped to more than one clonal tracking barcodes were excluded from downstream analyses. Around 20% of cells with single-cell transcriptome data were mapped to a tracking barcode.

A single blood draw from which genomic DNA was isolated from blood leukocytes of a female Boxer, Tasha, and which was also used to generate the previous CanFam 1, CanFam 2 and CanFam 3 genome assemblies, was utilized here. Continuous long-read (CLR) sequencing was carried out at Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) with a PacBio Sequel sequencer (Pacific Biosciences, Menlo Park, CA, USA). Approximately 100 µg of genomic DNA were used for sequencing. SMRTbell libraries were prepared using a DNA Template Prep Kit 1.0 (PacBio), and 56 20-kb SMRTbell libraries were constructed. A total of 252 Gb of sequence data were collected. High molecular weight DNA from Tasha was also sequenced with Chromium libraries (10x Genomics, Pleasanton, CA, USA) on Illumina (San Diego, CA, USA) HiSeq X (2 × 150 bp), generating 589,824,390 read pairs or 176 Gb of data.

Coridius chinensis was collected from Leshan, Sichuan, China (N29.52°, E103.43°). A single female adult of C. chinensis was prepared for de novo sequencing. Genomic DNA was extracted using the CTAB method, followed by purification using a Blood and Cell Culture DNA Midi Kit (QIAGEN, Germany). The genome assembly was performed using a hybrid sequencing approach, combining SMRT PacBio High-Fidelity (HiFi) reads, Illumina short reads, and Hi-C data. A long fragment library with an average insert size of approximately 15 kb was constructed from the extracted DNA. HiFi reads were generated using a PacBio Sequel sequencer (Pacific Biosciences, Menlo Park, USA), and Hi-C data were generated by Illumina NovoSeq platform. Additionally, RNA-Seq reads were generated from one male and one female using Illumina NovoSeq platform. All library construction and sequencing procedures were performed at Grandomics Biotechnology Co., Ltd (Wuhan, China).
For Hi-C sequencing, fresh tissues were obtained from a female individual of C. chinensis. The sample was cross-linked with formaldehyde isolation buffer, and then digested with DpnII restriction endonuclease. After ligation, the DNA fragments were split into a size of 350-bp, and the chromatin conformation capture library was sequenced on an Illumina NovoSeq platform.

Genomic DNA of P. humilis was extracted from young leaves using CTAB protocol with slightly modifications. The extracted and concentrated DNA was used to generate sequences following standard protocols with both PacBio Sequel sequencer (Pacific Biosciences of California, Menlo Park, CA, USA) and Illumina Hiseq (Illumina, San Diego, CA, USA) platforms at Personal Biotechnology Co., Ltd (Shanghai, China); 450-bp insertions libraries were prepared for Illumina Hiseq platform and 150-bp paired-end reads were obtained.

DNA library was constructed using the SMRTbell Express Template Prep Kit 2.0 (Pacific Biosciences, USA), and each constructed library was combined with a primer and DNA polymerase to form a primer/template/polymerase, using the DNA Polymerase Binding Kit P4 (Pacific Biosciences). All complexes were loaded onto the SMRT Cell using the MagBead kit (Pacific Biosciences), and the MagBead was combined with the complex to travel over the zero-mode waveguide (ZMW). Sequencing was performed using the DNA Sequencing Kit 2.0 (Pacific Biosciences) on a PacBio Sequel Sequencer (Pacific Biosciences). The biotin-modified DNA polymerase bound to streptavidin at the bottom of the ZMW, anchoring the complex. The DNA polymerase read the single-stranded circular DNA template several times to produce polymerase sequences.

One microgram of purified mitochondrial DNA was fragmented for 300-500 bp paired-end library construction using a TruSeq™ Nano DNA Sample Prep Kit. Sequencing was performed on the Illumina HiSeq 4000 platform (BIOZERON Co., Ltd., Shanghai, China). A DNA library with approximately 15-20 kb SMRTbell libraries was constructed and sequenced on a PacBio Sequel Sequencer (PacBio Inc., Menlo Park, CA, USA). For the cabbage mitochondrial genome assembly, the filtered Illumina HiSeq subreads were preliminarily assembled by ABySS v2.0.2 software (version 1.5) (Jackman et al., 2017 (link)). Then, the PacBio Sequel data were aligned by the blasR method for single-molecule sequencing data correction. The corrected PacBio Sequel data and Illumina HiSeq data were combined for the mitochondrial genome framework assembly using SPAdes v3.10.1 software (Antipov et al., 2016 (link)). Finally, clean Illumina HiSeq reads were mapped to the assembled mitochondrial genome to verify the accuracy of the sequence. The circular genome maps were drawn using OrganellarGenomeDRAW (version 1.2) (Greiner et al., 2019 (link)).