Lightcycler 480 sybr green master

Manufactured by Roche

Sourced in United States, Switzerland, Germany

The LightCycler 480 SYBR Green Master is a real-time PCR reagent kit designed for use with the LightCycler 480 instrument. It contains a SYBR Green I-based master mix for the detection and quantification of DNA targets.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (6 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions) Lightcycler 480, by Roche (5 mentions) Lightcycler 480 system, by Roche (4 mentions) Lightcycler 480 2 system, by Roche (4 mentions) Rneasy mini kit, by Qiagen (4 mentions) Iscript cdna synthesis kit, by Bio-Rad (4 mentions) Lightcycler 480 real time pcr system, by Roche (4 mentions) White 384 well plates, by Roche (3 mentions) Lc 480 2 system, by Roche (3 mentions) Lightcycler 480 2, by Roche (3 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Fastpure plant total rna isolation kit, by Vazyme (2 mentions) Lightcycler 480 2 machine, by Roche (2 mentions) Cfx96 real time pcr system, by Bio-Rad (2 mentions) Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions) Nucleospin rna kit, by Macherey-Nagel (2 mentions) Primescript 2 1st strand cdna synthesis kit, by Takara Bio (2 mentions) Tri reagent, by Merck Group (2 mentions) All in one rt mastermix, by Applied Biological Materials (2 mentions)

54 protocols using lightcycler 480 sybr green master

Quantification of Circular Extrachromosomal DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from Col-0 and nrpd1-3 Arabidopsis plants or from rice calli grown with or without Tenofovir, using the plant DNeasy kit (Qiagen) according to the manufacturer's instructions. The presence of ONSEN and Tos17 circular ecDNA was tested using inverse-PCR with primers designed inside LTRs in opposite directions (Supplemental Table 7). The PCR reaction was performed using GoTaq polymerase (Promega). The PCR conditions were as follows: (i) ONSEN—95°C 2 min, 35 cycles 95°C 30 s, 58°C 30 s, 72°C 2 min; (ii) Tos17—95°C 2 min, 35 cycles 95°C 30 s, 55°C 30 s, 72°C 30 s. PCR amplicons from actin and eEF-1a were used as loading controls for ONSEN and Tos17, respectively.
qPCR analysis of LTR-TE DNA was performed on a LightCycler480 (Roche) using LightCycler 480 SYBR Green Master (Roche) with three technical replicates for each sample. For ONSEN, the relative copy number was calculated using the actin 2 gene and C-REPEAT/DRE BINDING FACTOR 2 as reference and normalized by DNA levels in Col-0 collected at CS0. For Tos17, the relative copy number of circular extrachromosomal DNA was calculated using Ubiquitin as a reference and normalized by DNA levels measured in the samples collected from untreated calli. Primers used are listed in Supplemental Table 7.

Brestovitsky A., Iwasaki M., Cho J., Adulyanukosol N., Paszkowski J, & Catoni M. (2022). Specific suppression of long terminal repeat retrotransposon mobilization in plants. Plant Physiology, 191(4), 2245-2255.

+ Open protocol

+ Expand

Quantitative RT-PCR Validation of Pear Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Several expressed genes were selected for verification by quantitative RT-PCR (qRT-PCR) on ‘Starkrimson’. Coding sequences of the genes were acquired from the pear genome project (http://peargenome.njau.edu.cn). Primers for the candidate genes were designed (Table S1) with the online software Primer 3 (http://simgene.com/Primer3). The LightCycler 480 SYBR GREEN Master (Roche, USA) system was used, with GAPDH as the house-keeping gene. Reactions of target genes and reference genes were performed in triplicate in a total volume of 20 μl. PCR reactions were carried out via an initial incubation at 95 °C for 10 min and at 95 °C for 15 s, and then cycled at 60 °C for 15 s, and 72 °C for 20 s for 40 cycles, and final extension at 72 °C for 30 min.

Zhang M.Y., Xue C., Xu L., Sun H., Qin M.F., Zhang S, & Wu J. (2016). Distinct transcriptome profiles reveal gene expression patterns during fruit development and maturation in five main cultivated species of pear (Pyrus L.). Scientific Reports, 6, 28130.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Levels of caspase-1, caspase-9, GSDMD, and MVP mRNA were determined by quantitative real-time PCR using a LightCycler 480 instrument (Roche, Basel, Switzerland) and LightCycler 480 SYBR Green Master (Roche). mRNA levels were normalized to RPL27. Primers were purchased from Microsynth (Balgach, Switzerland) (Supplementary Table S2).

Grossi S., Fenini G., Kockmann T., Hennig P., Di Filippo M, & Beer H.D. (2020). Inactivation of the Cytoprotective Major Vault Protein by Caspase-1 and -9 in Epithelial Cells during Apoptosis. The Journal of investigative dermatology, 140(7).

+ Open protocol

+ Expand

Embryonic Total RNA Extraction and RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from 30 embryos using Trizol (Invitrogen) following recommendations from the manufacturer. For RT-qPCR, 1 μg of total RNA was reverse transcribed using Superscript III (Invitrogen) and random hexamers. Quantitative PCR (qPCR) was performed on a LightCycler LC480 (Roche) with Lightcycler 480 SYBR green master (Roche) and primers are listed in Supplementary information, Table S3. Quantifications were performed in triplicate.

Ramat A., Garcia-Silva M.R., Jahan C., Naït-Saïdi R., Dufourt J., Garret C., Chartier A., Cremaschi J., Patel V., Decourcelle M., Bastide A., Juge F, & Simonelig M. (2020). The PIWI protein Aubergine recruits eIF3 to activate translation in the germ plasm. Cell Research, 30(5), 421-435.

+ Open protocol

+ Expand

Real-time RT-PCR Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time RT-PCR was performed in a total of 12 µl mixture solution in 384-well plates using the LightCycler 480 system (Roche Applied Science, Mannheim, Germany). Each 12 µl of reaction mixture contains 6 ml of LightCycler 480 SYBR Green Master (Roche Diagnostics GmbH, Mannheim, Germany), 0.5 mM primers and diluted cDNA. Real-time RT-PCR quantifications were run in triplicate for each sample and the average determined. PCR products were quantified by the LightCycler 480 software. Melting curve and gel electrophoretic analyses were used to determine amplification homogeneity and data quality. Expression levels were normalized to β-actin. The primer sequences have been described previously [12 (link),20 (link)].

Luo C., Zhao J., Chen M, & Xu H. (2018). The expression of C1 inhibitor (C1INH) in macrophages is upregulated by retinal pigment epithelial cells – implication in subretinal immune privilege in the aging eye. Aging (Albany NY), 10(6), 1380-1389.

+ Open protocol

+ Expand

Quantification of Phytohormones in M. baccata

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 0.5 g of the leaves of the M. baccata seedlings were collected after 24 days of Fe de ciency and exogenous Res treatment for the detection of endogenous hormones, including IAA, GA3, ABA, DHZR, BL, and JA-Me. Measurement of the endogenous hormone content was performed using electrospray ionization-high-performance liquid chromatography-tandem mass spectrometry in accordance with the method described by Zhuo et al (Zhuo et al. 2019) . Each experiment was independently repeated three times.
Quantitative RT-PCR (RT-qPCR) assay Total RNA was extracted from the roots of the M. baccata seedlings by using a FastPure Plant Total RNA Isolation Kit (Vazyme, Nanjing, China), and the cDNA was synthesized from 2 μg of total RNA by using 5× All-In-One RT MasterMix (ABM, Sydney, Australia). LightCycler® 480 SYBR Green Master (Roche, Mannheim, Germany) with a LightCycler® 480 II system (Roche, Rotkreuz, Switzerland) was used for the qPCR assay, and the primers are listed in Table S1. The primer sequences for qPCR were designed in accordance with the coding sequence of genes in Primer 5 software and checked using a BLAST search in the apple genomic database. The relative expression was calculated with the 2 -∆∆Ct method. Each experiment was independently repeated three times.

Zheng X., Chen H., Su Q., Wang C., Sha G., Ma C., Sun Z., Yang X., Li X., & Wang C. (2021). Resveratrol Improves the Iron Deficiency Adaptation of Malus Baccata Seedlings by Regulating Iron Absorption, Phytohormone Content, and ROS Migration.

+ Open protocol

+ Expand

Cellular RNA Isolation and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was isolated using an RNA-Quick Purification Kit (Yishan Biotechnology, Shanghai, China) according to the manufacturer’s instructions. Exosomal RNA was isolated according to the established protocol with TRIzol (Invitrogen, Carlsbad, CA, USA). qRT-PCR was proceeded on LightCycler 480 SYBR Green Master (Roche Diagnostics, Mannheim, Germany). β-actin and U6 were used as internal RNA standards for mRNA and miRNA respectively.

Liu J., Wang J., Fu W., Wang X., Chen H., Wu X., Lao G., Wu Y., Hu M., Yang C., Yan L, & Ren M. (2021). MiR-195-5p and miR-205-5p in extracellular vesicles isolated from diabetic foot ulcer wound fluid decrease angiogenesis by inhibiting VEGFA expression. Aging (Albany NY), 13(15), 19805-19821.

+ Open protocol

+ Expand

Gene Expression Profiling for Neuroblastoma Prognosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Data comes from a previously published study that developed and validated the expression profile of a 59-mRNA gene to improve prognosis in children with neuroblastoma. This dataset measured 59 biomarkers and 5 reference genes in a sample maximization experimental design, using the LightCycler480 SYBR Green Master (Roche) in a 384-well plate with 8 μl reaction. These genes have been reported in at least two independent studies as prognostic genes for neuroblastoma. 366 cDNA samples from the primary tumor biopsy and a 5-point 10-fold serial dilution series based on an external oligonucleotide standards (from 150,000 to 15 copies, n = 3), and no template control (NTC, n = 3) are included in each plate [8] .
This dataset will be referred to as 'biomarker dataset' in this study and 20 genes were selected from this dataset for analysis.

Zhang Y., Li H., Shang S., Meng S., Lin T., & Zhang Y. (2020). Evaluation validation of a qPCR curve analysis method and conventional approaches.

+ Open protocol

+ Expand

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression was investigated using a LightCycler 480 SYBR Green Master (Roche, Basel, Switzerland) or a SsoAdvanced™ Universal SYBR^® Green Supermix (Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s protocols (40 cycles, 60 °C as the primer annealing temperature). Quantification of expression was performed using the 2^−ΔΔCT method [46 (link)]. Relative expression levels were calculated using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a reference gene. Primer pairs are presented in the Supplementary Table S1. Primer pairs were verified by analyzing the melting curve with single amplicons. Primer pairs for LEF1, BMP4, Noggin, and KLF4 were purchased from Qiagen as QuantiTech primers.

Yoshida Y., Takahashi M., Yamanishi H., Nakazawa Y., Kishimoto J, & Ohyama M. (2022). Changes in the Expression of Smooth Muscle Cell–Related Genes in Human Dermal Sheath Cup Cells Associated with the Treatment Outcome of Autologous Cell–Based Therapy for Male and Female Pattern Hair Loss. International Journal of Molecular Sciences, 23(13), 7125.

+ Open protocol

+ Expand

Quantification of HBV DNA and RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HBV‐DNA and RNA levels in the culture medium of HepAD38 cells and sera of patients were detected by qPCR in the LightCycler 480 II Real‐time PCR Detection System (Roche, Mannheim, Germany) with a SYBR Green method. The four pairs of primers used to detect different regions of HBV DNA and RNA are as follows: rcDNA‐F(1778‐1798 nt): 5′‐GGAGGCTGTAGGCATAAATTGG‐3′, rcDNA‐R(1883‐1862 nt): 5′‐CACAGCTTGGAGGCTTGAAC‐3′; PreC/C‐F(2299‐2319 nt): 5′‐ AGACCACCAAATGCCCCTATC‐3′, PreC/C‐R(2397‐2378 nt): 5′‐ TCTGCGAGGCGAGGGAGTTC‐3′; S‐F(303‐322 nt): 5′‐TGGCCAAAATTCGCAGTCCC‐3′, S‐R(448‐425 nt): 5′‐GAAGAACCAACAAGAAGATGAGGC‐3′; X‐F(1608‐1628 nt): 5′‐CATGGARACCACCGTGAACG, X‐R(1800‐1776 nt): 5′‐CCAATTTATGCCTACAGCCTCCT‐3′. The serial dilutions of pBB4.5‐1.2×HBV plasmid were used as standards of quantification. The qPCR reaction mixture (20 μL) contained 10 μL of 2× mix (LightCycler 480 SYBR green Master; Roche), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of DNA (for DNA detection) or 1 μL of complementary DNA template (for RNA detection), and 7 μL of double‐distilled water (ddH₂O). The reaction mixture was denatured at 95°C for 5 minutes, followed by 45 cycles at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

Liu Y., Liu H., Hu Z., Ding Y., Pan X., Zou J., Xi J., Yu G., Huang H., Luo M., Guo F., Liu S., Sheng Q., Jia J., Zheng Y., Wang J., Chen X., Guo J., Wei L, & Lu F. (2019). Hepatitis B Virus Virions Produced Under Nucleos(t)ide Analogue Treatment Are Mainly Not Infectious Because of Irreversible DNA Chain Termination. Hepatology (Baltimore, Md.), 71(2), 463-476.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!