Log In Sign up
The largest database of trusted experimental protocols

Reverse transcription master mix kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The Reverse Transcription Master Mix kit is a reagent solution designed for the conversion of RNA to cDNA. It contains the necessary components, including reverse transcriptase enzyme and buffer, to perform this essential step in the analysis of gene expression and other RNA-based applications.

Automatically generated - may contain errors

Lab products found in correlation

Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Trypsin, by Thermo Fisher Scientific (2 mentions) Anti β tubulin, by Thermo Fisher Scientific (2 mentions) Penicillin streptomycin combination, by Thermo Fisher Scientific (2 mentions) Protein lysis buffer, by Solarbio (2 mentions) Dmem medium, by Thermo Fisher Scientific (2 mentions) Trzol, by Thermo Fisher Scientific (2 mentions) Anti α7nachr, by Abcam (2 mentions) Anti phospho p65 nf κb 3033s, by Cell Signaling Technology (2 mentions) Alexafluor488 mouse secondary antibody, by Thermo Fisher Scientific (2 mentions) Alexafluor488 rabbit secondary antibody, by Thermo Fisher Scientific (2 mentions) Anti phospho iκb, by Cell Signaling Technology (2 mentions) Sybr select master mix, by Thermo Fisher Scientific (1 mentions) Anti il 1β, by Abcam (1 mentions) Anti iκb, by Cell Signaling Technology (1 mentions) Anti cd68, by Abcam (1 mentions)

Close spelling variants of this product

Reverse transcription kit (1270 citations) Reverse Transcription Master kit (5 citations) 2X Reverse Transcription master mix (3 citations) Reverse transcription mix (3 citations) Transcription Kits (2 citations)

3 protocols using reverse transcription master mix kit

1

Molecular Mechanisms of Microglial Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tris, sodium dodecyl sulfate (SDS), 30% acrylamide and protein lysis buffer (#R0010) were obtained from Solarbio Science & Technology Company (Beijing, China). TRzol was purchased from Ambion company (Texas, United States). Anti-CD11b (#ab1211, #ab133357), anti-IL-1β (#ab9787), anti-CD40 (#ab13545), anti-CD68 (#ab125212), and anti-α7nAChR (#ab10096) were purchased from Abcam (Cambridge, United Kingdom). Anti-IKK (#2682s), anti-phospho-IKK(#2697s), anti-P65-NF-κB (#242s), anti-phospho-P65--NF-κB (#3033s), anti-IκB (#4814s) and anti-phospho-IκB (#9246s) were purchased from Cell Signaling Technology (Massachusetts, United States). Anti-β-tubulin (#MA511732), AlexaFluor488 mouse secondary antibody (#A11029), AlexaFluor488 rabbit secondary antibody (#A11034), enhanced chemiluminescence reagent (ECL) Western blotting detection reagents (#32106), Reverse Transcription Master Mix kit (Invitrogen, #4374966), SYBR® Select Master Mix (Life Technologies, #4472908), 0.25% trypsin (Gibco, #25200-056), DMEM medium (Gibco, #31800-014), fetal bovine serum (FBS) (Gibco, #10099-141) and penicillin streptomycin combination (Gibco, #15140-122) were purchased from Thermo Fisher Scientific (Massachusetts, United States). 2-, 3-, 5-triphenyltetrazolium chloride (TTC, #T8877-25G) was purchased from Sigma (United States).
Liu C., Liu S., Xiong L., Zhang L., Li X., Cao X., Xue J., Li L., Huang C, & Huang Z. (2021). Genistein-3′-sodium sulfonate Attenuates Neuroinflammation in Stroke Rats by Down-Regulating Microglial M1 Polarization through α7nAChR-NF-κB Signaling Pathway. International Journal of Biological Sciences, 17(4), 1088-1100.
+ Open protocol
+ Expand
2

Quantification of Ischemic Neuroinflammation Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mRNA levels of CD11b, CD206, CD68, IL-1β, TNF-α and NF-κB p65 in the rat cerebral ischemic penumbra were measured using qPCR. Total RNA was extracted from the brain tissue using a TRIzol RNA Mini Kit (Ambion) according to the manufacturer’s instructions. Total RNA (3 μg) was transcribed into cDNAs using a Reverse Transcription Master Mix Kit (Invitrogen). qPCR was performed using EvaGreen and the BioMark HD Nanofluidic qPCR System combined with the GE 96.96 Dynamic Array IFC System. The relative expression levels of the genes were calculated using the 2−ΔΔCT method by comparing the expression of the gene to that of β-actin, an endogenous control gene. The primers (5′-3′) used in this study are listed in Table 2. Experiments were performed in triplicate.

The information of primers used in this study

Gene namePrimer sequences
ForwardReverse
ACTBCTAAGGCCAACCGTGAAAAGACCAGAGGCATACAGGGACA
CD11bCTGCTCCTCAAGGTCGTTGTAGATGGCGTACTTCACAGGC
CD206TTCCTTTGGACAGACGGACGTCCCTGCCTCTCGTGAATTG
CD68TTCGGGCCATGCTTCTCTTGGTCTCCGGGTAACGCAGAAG
IL-1βAACTCAACTGTGAAATGCCACCCATCAGGACAGCCCAGGTC
NF-κB p65GGACCTATGAGACCTTCAAGAGCAGAAGTTGAGTTTCGGGTAGG
TNF-αCCACCACGCTCTTCTGTCTACAGGGTCTGGGCCATAGAACT
Yu Z., Su G., Zhang L., Liu G., Zhou Y., Fang S., Zhang Q., Wang T., Huang C., Huang Z, & Li L. (2022). Icaritin inhibits neuroinflammation in a rat cerebral ischemia model by regulating microglial polarization through the GPER–ERK–NF-κB signaling pathway. Molecular Medicine, 28, 142.
+ Open protocol
+ Expand
3

Molecular Mechanisms of Neuroinflammation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tris, sodium dodecyl sulfate (SDS), 30% acrylamide and protein lysis buffer (#R0010) were obtained from Solarbio Science & Technology Company (Beijing, China). TRzol was purchsed from Ambion company (Texas, United States). Anti-CD11b (#ab1211), anti-IL-1β (#ab9787), anti-CD40 (#ab13545), anti-CD68 (#ab31630), and anti-α7nAChR (#ab10096) were purchased from Abcam (Cambridge, United Kingdom). Anti-IKK (#2682s), anti-phospho-IKK(#2697s), anti-P65-NF-κB (#242s), anti-phospho-P65--NF-κB (#3033s), anti-IκB(#4814s) and anti-phospho-IκB (#9246s) were purchased from Cell Signaling Technology (Massachusetts, United States). Anti-β-tubulin (#MA511732), AlexaFluor488 mouse secondary antibody (#A11029), AlexaFluor488 rabbit secondary antibody (#A11034), enhanced chemiluminescence reagent (ECL) Western blotting detection reagents (#32106), Reverse Transcription Master Mix kit (Invitrogen, #4374966), SYBR Ò Select Master Mix (Life Technologies, #4472908), 0.25% trypsin (Gibco, #25200-056), DMEM medium (Gibco, #31800-014), fetal bovine serum (FBS) (Gibco, #10099-141) and penicillin streptomycin combination (Gibco, #15140-122) were purchased from Thermo Fisher Scienti c (Massachusetts, United States). 2-, 3-, 5-triphenyltetrazolium chloride (TTC, #T8877-25G) was purchased from Sigma (United States).
Liu C., Liu S., Xiong L., Li X., Cao X., Xue J., Li L., Huang C., & Huang Z. (2020). Genistein-3′-sodium Sulfonate Attenuates Cerebral Ischemia/reperfusion Injury in Rats by Down-regulating Microglial M1 Polarization Through α7nAChR-mediated Inhibition of NF-κb Signaling Pathway .
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!