All candidate RT-qPCR assays independently tested one COVID-19-confirmed clinical sample using PrimeScriptTM RT-PCR (Perfect Real-time) kit (TaKaRa Biotechnology, Japan) by three times to screen the optimum primer-probe set. Each assay was performed in a 25 μl reaction volume containing 12.5 μl of buffer, 0.5 μl of TaKaRa Ex TaqTM HS, 0.5 μl of enzyme mix, 0.48 μM of each primer, 0.24 μM probe, 5 μl of RNase-free water, and 5 μl of RNA template. Amplifications were performed on a 7500 Fast Real-Time PCR system (Applied Biosystems, Waltham, MA, United States) using the following conditions: 10 min at 42°C for reverse transcription, 2 min at 95°C for initial denaturation, followed by 45 cycles of 95°C for 10 s and 55°C for 30 s. The fluorescence signal was acquired at the end of each annealing step. The cycle threshold value (Ct) and fluorescence intensity of designed primer–probe sets were recorded and compared. The candidate assay yielded the lowest Ct-value, and the strongest fluorescence response was selected for further analysis.
Takara ex taqtm hs
Manufactured by Takara Bio
Sourced in Japan
TaKaRa Ex TaqTM HS is a high-sensitivity DNA polymerase designed for PCR amplification. It provides efficient and reliable DNA synthesis with high thermal stability.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt pcr kit perfect real time, by Takara Bio (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Miseq v3, by Illumina (1 mentions)
Fastgene gel pcr extraction kit, by Nippon Genetics (1 mentions)
Picogreen dsdna assay kit, by Thermo Fisher Scientific (1 mentions)
2 protocols using takara ex taqtm hs
1
RT-qPCR Screening for COVID-19 Detection
2
High-throughput 16S rRNA Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A high-throughput analysis of 16 rRNA gene sequences was carried out according to the previous method. Areas V3-V4 of the sequences from the bacteria were amplified with the fecal DNA genome (approximately 1 ng) using TaKaRa Ex TaqTM HS (Takara Bio, Japan) and universal primer Bakt_341F (5’-CGCTCTTCCGATCTCTG CCTACGGGGGGGCWGCAG-355)GGCTATICCCACCATTCCCCATTCCACCA CCACCACCACCACCACCACCACCA UTAA. The amplification results were used as a template for the second PCR using barcode-tag primers. The second PCR results were purified using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Japan) according to company protocol. The purified products were quantified using the PicoGreen® dsDNA Assay Kit (Life Technologies, United States) based on company protocol. All the PCR samples were of the same total amount (approximately 200 ng total), and they were purified using electrophoresis in 2% (w/v) agarose gel (classic-type Agarose-LE: Nacalai Tesque, Japan), followed by extraction from the gel by the FastGene Gel/PCR Extraction Kit. The purified mixture was applied to the final-pair sequence of Illumina MiSeq v3 (Illumina, United States).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!