Quantstudio 3 flexreal time pcr system

Reverse transcription was performed from 500 ng of total RNA using the ReverTra Ace qPCR RT Kit. 37°C for 15 min, followed by reverse transcriptase inactivation at 85°C for 5 min was utilized. The cDNA was used for PCR or stored at −80°C immediately. The expression of snoRNAs was analysed by custom TaqMan assays (Applied Biosystems), using the QuantStudio™ 3 Flex Real‐Time PCR System (Applied Biosystems) and using the following condition: 95°C for 1 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s and 72°C for 1 min. Primers were as follows: SNORA2 forward (5′‐ATTCAAGGCCAGCAGTTTGC‐3′) and SNORA2 reverse (5′‐AGATGGCCAACAGACCATGAA‐3′); SNORD12B forward (5′‐TCCTGCTGGCATATATGATGACTT‐3′) and SNORD12B reverse (5′‐GCTCAAGCTGGCATATCAGAC‐3′); SNORA59B forward (5′‐CCTCACAACGTTTGTGCCTC‐3′) and SNORA59B reverse (5′‐AGCTGTTCCTTATCACCAACGA‐3′); SNORA70B forward (5′‐TCCTTATGGGGGTCCAGTGT‐3′) and SNORA70B reverse (5′‐CAACAAACAGGCCGCATACA‐3′); SNORD93 forward (5′‐GCCAAGGATGAGAACTCTAATCTGA‐3′) and SNORD93 reverse (5′‐GGCCTCAGGTAAATCCTTTAATCCA‐3′); SNORD116‐2 forward (5′‐TGGATCGATGATGAGTCCCC‐3′) and SNORD116‐2 reverse (5′‐AGTTCCGATGAGAATGACGGT‐3′). The expression levels of snoRNAs were calculated using the 2^−ΔCt method.21

Quantification of RAW264.7 immune gene expression was performed using SYBR® Premix Ex Taq™ II. The reaction mixture consisted of 0.4 μM of each specific primer pair (Table 1) and 0.1 ng of cDNA template. Quantitative Real-Time PCR was performed and analyzed with the QuantStudio 3 Flex real‐time PCR system (Applied Biosystems, Foster City, CA) using a relative standard curve method compared with β-actin as an internal control of immune gene expression.

TRI reagent^® (Molecular Research Center, Inc., Cincinnati, OH, USA) was used to isolate the total RNA from the cells. The lysate was homogenized with 200 µL of chloroform after being transferred to a 1.5 mL microtube. After that, centrifugation was performed at 13,000 rpm at 4 °C for 10 min. In a new 1.5 mL microtube, the supernatant and isopropanol were added and incubated at 4 °C for 30 min. The pellet was obtained after 10 min of centrifugation at 13,000 rpm at 4 °C. Before being dissolved in nuclease-free water and maintained at −20 °C, the total RNA was washed three times with 70% ethanol. The cDNA was produced using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA), after the RNA was extracted.
The expression of immune genes was measured using amplification reactions, including 5 ng of cDNA, SYBR Premix EX Taq II (Takara Bio Inc., Kusatsu, Japan), and the specific primer sets of IL-1β, IL-6, TNF-α, iNOS, COX-2, and β-actin [32 (link)]. On a QuantStudio™ 3 FlexReal-Time PCR System (Applied Biosystems, Waltham, MA, USA), the experiment was carried out in triplicate and analyzed.