Lentiviral gfp vector

Lentiviral GFP vectors containing the S100A8 shRNA or scrambled shRNA sequence (5′-AACTTGTTCAGAGAATTGGACATCAATAG-3′) were purchased from Origene (Rockville, MD, USA). Cells were transfected with S100A8 shRNA or scramble shRNA using Lipofectamine 3000 reagent (Invitrogen, Waltham, Massachusetts, USA) in a serum-reduced medium, according to the manufacturer’s instructions. After 6 h, the medium was changed to complete medium, and the cells were incubated for another 24 h before performing other experiments.

Each cell line was transfected with PKD1 overexpressing plasmid in the lentiviral GFP vector (Origene, Rockville, MD, USA) using TransIT-X2 (Mirus Bio, Madison, WI, USA) according to the manufacturer’s instructions. To improve the transfection efficacy and induce high expression of the PKD gene, transfection was repeated twice in the same cells while maintaining minimal toxicity to the cells, and then media was replaced at 24 h post-transfection. Transfected cells were used in experiments after 48 h incubation.

To induce Mfn2 knockdown, commercially available 29mer short-hairpin RNA (shRNA) constructs in lentiviral GFP vector (Origene, Rockville, USA, TL712567) were used. Two constructs, sh-Mfn2 B and sh-Mfn2 D, were selected for the experiments, based on satisfactory efficiency in Mfn2 reduction with a relatively low toxicity. As a negative control, a non-effective 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector was used (scrRNA; Origene). Viral production was performed as described in Gruszczynska-Biegala et al. (2020) [34 ]. Neurons were infected with sh-Mfn2 and scrRNA- carrying lentiviruses on DIV4 with a viral infection efficiency exceeding 90%. The experiments were performed 6 days post transduction (DIV 10).

We purchased the four unique 29mer shRNA constructs in a lentiviral GFP vector (#TL501193; Origene). To prepare the liposome, dimethyldioctadecylammonium bromide (#D2779; Sigma-Aldrich) was dissolved in chloroform (#C606SK-1; Fisher Chemical) in a 1:1 M ratio with cholesterol (#228111; Millipore). In a Rotavapor (#R-300; Buchi), chloroform was evaporated at 37°C, 100 rpm for 20–30 min. The dried lipid film was resuspended in 5% dextrose (#D16–500; Thermo Fisher Scientific) in water and further sonicated in Branson 2510 Ultrasonic Cleaner (#Z244910; Sigma-Aldrich) for 30 min, followed by 0.45 μm filtration. Liposome–shRNA (a cocktail of four shRNAs) complex was prepared with a concentration of 50 μg DNA/100 μg liposome per mouse (Liu et al., 2019 (link)). The physical characterization of the prepared liposome-shRNA complex was performed by measuring the hydrodynamic size and the surface zeta potential by using Malvern Zetasizer. The mice were fully anesthetized with ketamine/xylazine and the liposomes were i.t. injected.

shRNAs for ASM constructs in lentiviral GFP vector (#TL309232) were purchased from OriGene Technologies (Rockville, MD, USA):
ASM-shRNA1: ACCGAATTGTAGCCAGGTATGAGAACACC
ASM-shRNA2: GGAACATCTCTTTGCCTACTGTGCCGAAG
Cont-shRNA: GCACTACCAGAGCTAACTCAGATAGTACT
Lentiviruses carrying the shRNAs were produced in 293T cells using a Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) according to manufacturer’s instruction. HT-1080 cells were infected by these viruses and were selected with 0.2 μg/mL puromycin. Scrambled control shRNA was used as a control.