The largest database of trusted experimental protocols

Pgfp c shlenti vector

Manufactured by OriGene
Sourced in United States

The PGFP-C-shLenti vector is a lentiviral expression vector designed for the expression of short hairpin RNA (shRNA) in mammalian cells. It contains a puromycin resistance gene for selection of transduced cells and a green fluorescent protein (GFP) reporter for monitoring transduction efficiency.

Automatically generated - may contain errors

35 protocols using pgfp c shlenti vector

1

Knockdown of α2δ1 and α2δ3 Subunits

Check if the same lab product or an alternative is used in the 5 most similar protocols
For knockdown of the α2δ1 subunit, siRNA target sequences corresponding to the α2δ1 coding region (CACNA2D1, GenBank accession number NM_009784.2) (Obermair et al., 2005 (link)) were selected and tested for efficient knockdown. The siRNA was expressed as shRNA under the control of a U6 promoter (derived from the pSilencer1.0-U6 siRNA expression vector, Ambion) cloned into the pβA-eGFP plasmid (Obermair et al., 2010 (link)). For lentiviral expression, α2δ1 shRNA was cloned into pHR as previously described (Subramanyam et al., 2009 (link)). For knockdown of the α2δ3 subunit, four 29mer shRNA constructs against rat Cacna2d3 (Gene ID 306243) cloned in lentiviral GFP vector (pGFP-C-shLenti Vector, catalog #TR30023) were ordered from OriGene Technologies (catalog #TL713428). Based on their specificity for rat and mouse α2δ3, two of these constructs were tested for their knockdown efficiency where the construct “C” was evaluated to results in a reduction of α2δ3 expression down to 40%-50%. As control for α2δ-knockdown experiments, a noneffective 29-mer scrambled shRNA cassette cloned into pGFP-C-shLenti Vector (catalog #TR30021; OriGene Technologies) was used.
+ Open protocol
+ Expand
2

Knockdown of ANGPTL4 in MDA-MB-231 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T cells grown to 70% confluence in DMEM were transfected with pGFP-C-shLenti vectors expressing four unique 29-mer shRNAs for human ANGPTL4 (ANGPTL4 human shRNA, OriGene Technologies, Inc.), and a control 29-mer scrambled shRNA cassette (Control shRNA) in the pGFP-C-shLenti Vector (OriGene Technologies, Inc.) by using TurboFectin transfection reagent (OriGene Technologies, Inc.) following the manufacturer’s instructions. The culture media was changed after 12–18 h of incubation. Two batches of the viral supernatants of 293T cells were collected 48 and 72 h after transfection and combined and then filtered to remove cellular debris. MDA-MB-231 cells with stable knockdown of ANGPTL4 (Angptl4shRNA) and an empty vector control (ConshRNA) were established by incubation of MDA-MB-231 cells with the viral supernatant for 5 h and puromycin selection for at least 2 weeks. The transfection efficiency was monitored by positive GFP expression. Efficient shRNA-mediated knockdown of ANGPTL4 in MDA-MB-231 cells was confirmed by qPCR. Those colonies with the best knockdown efficiency of ANGPTL4 were used for experiments.
+ Open protocol
+ Expand
3

Modulating Key Cellular Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
SOX2 or YAP1 shRNA pGFP-C-shLenti Vector (SOX2-sh or YAP1-sh) was used for the knockdown of the gene expression (Origene). Non-effective 29-mer scrambled shRNA pGFP-C-shLenti Vector (Origene) was used as a control (SOX2- or YAP1-Ctrl). EF1A-Human-SOX2 lentivirus (SOX2-LV) for SOX2 induction, LentimiRa-GFP-has-let-7 lentivirus (let-7-LV) for let-7 induction, and YAP1 overexpressing lentivirus (YAP1-LV) for YAP1 induction were purchased from Cellomics Technology, Applied Biological Materials, and GenTarget, respectively. EF1A-vector control lentivirus, Lenti-III-mir-GFP control lentivirus, and CMV control lentivirus were used as controls, respectively. For the knockdown of COX2, COX-2 Silencer Select siRNA (Thermo Fisher Scientific) was used.
+ Open protocol
+ Expand
4

SHMT2 Silencing in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SHMT2 expression was silenced using a commercial pGFP-C-shLenti vector (catalog No: TL309453V, OriGene Technologies, Inc., Rockville, MD, USA). This vector was designed to specifically inhibit SHMT2 expression (shSHMT2-1:5′-AAG ACTGCCAAGCTCCAGGATTTCAAATC-3′; shSHMT2-2:5′- AAGTCAAAGCACACCTGCTGGCAGACATG-3′) and encodes green fluorescent protein as a marker of transfection. Lenti-shRNA scramble control particles were used as a negative control (catalog No: TR30021V, OriGene Technologies, Inc., Rockville, MD, USA). FADU and SNU1041 cells were infected with shRNA-expressing lentiviruses and selected with puromycin.
+ Open protocol
+ Expand
5

Lentivirus Transduction of Primary Hippocampal Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols
Some cultures were infected with lentiviruses five days before experiments. Lentiviruses were generated by transfecting HEK293T with polyethyleneimine and a mixture of three plasmids: envelope vector pMD2.G, packaging vector psPAX2 (AddGene #12259 and #12260 were gifts from Didier Trono), pGFP-C-shLenti vector (OriGene, Rockville, MD, USA, TR30021, referred to as mock shRNA), shRNA STIM1 or shRNA STIM2 vectors (a kind gift from prof. I. Bezprozvanny, Southwestern. Medical Center, Dallas, TX, USA). The supernatant with viruses was harvested 48 and 72 h after transfection, filtered, and concentrated by centrifugation (47,000 g, 2 h, 4 °C). Pellets were resuspended in NeuroBasal-A, aliquoted, and stored at −80 °C. Transduction efficacy was confirmed by western blotting and immunostaining of primary hippocampal neuron cultures of C3Ha mice.
+ Open protocol
+ Expand
6

Lentiviral shRNA Knockdown of PHLPP-1 in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentiviral plasmids encoding shRNAs for PHLPP-1 were constructed in pGFP-C-shLenti vector (Catalog # TR30023) purchased from OriGene Technologies, Inc. A plasmid carrying a non-targeting sequence was used to create the control cells. For virus packaging, the control or PHLPP-specific shRNA constructs were co-transfected with Mission lentiviral packing mix (Sigma-Aldrich) [39 (link)]. Sprague–Dawley rats underwent gene transfer via aortic cross-clamping as previously described [25 (link)]. After dissection of the aorta and pulmonary artery, lentiviral shPHLPP-1 was injected into the left ventricular cavity through a 22G catheter while the aorta and pulmonary artery were cross-clamped for 50 s. In negative control animals, sh-Con lentivirus was injected into the left ventricular cavity while the aorta and pulmonary artery were cross-clamped for 50 s. After cross-clamping was released, the chest was closed. Myocardial PHLPP-1 expression was analyzed 72 hours later by western blotting.
+ Open protocol
+ Expand
7

Lentiviral Transduction of ErbB and PDGFRα Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ErbB1, ErbB2, ErbB4 and PDGFRα were ordered from GenEZ™ ORF database (Genscript). Lentiviral vectors were generated by cloning ErbB1, ErbB2, ErbB4 and PDGFRα in pCDH-EF1-MCS (System Biosciences). Lentiviral particles were generated by PEI transfection of HEK293FT (Invitrogen) with pCDH, pMD2.G (addgene), psPAX (addgene) and purified on a sucrose cushion. ARPE-19 and MRC-9 were transduced at 60% confluency and expression was accessed after two days. Down regulations of ErbB1, ErbB2 and PDGFRα were done by lentiviral transduction of cells using 4 unique 29mer shRNA constructs in pGFP-C-shLenti and 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector (Origene) using manufacturer’s instructions. Best constructs were selected by puromycin selection and effective down regulation of the target gene without decrease in cell viability. Sequence of the shRNAs used are listed thereafter.

ErbB1: 5′_ATGGAGGAAGACGGCGTCCGCAAGTGTAA_3′,

ErbB2: 5′_TGTTGGATGATTGACTCTGAATGTCGGCC_3′

ErbB4: 5′_TGTAAGGCAATGCTGCCTACTATCAAACT_3′

PDGFRα: 5′–AGTTCCACCTTCATCAAGAGAGAGGACGA_3′

Scrambled: 5′_GCACTACCAGAGCTAACTCAGATAGTACT_3′

+ Open protocol
+ Expand
8

Lentiviral Mfn2 Knockdown in Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols
To induce Mfn2 knockdown, commercially available 29mer short-hairpin RNA (shRNA) constructs in lentiviral GFP vector (Origene, Rockville, USA, TL712567) were used. Two constructs, sh-Mfn2 B and sh-Mfn2 D, were selected for the experiments, based on satisfactory efficiency in Mfn2 reduction with a relatively low toxicity. As a negative control, a non-effective 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector was used (scrRNA; Origene). Viral production was performed as described in Gruszczynska-Biegala et al. (2020) [34 ]. Neurons were infected with sh-Mfn2 and scrRNA- carrying lentiviruses on DIV4 with a viral infection efficiency exceeding 90%. The experiments were performed 6 days post transduction (DIV 10).
+ Open protocol
+ Expand
9

Lentiviral Knockdown of ASPP2κ in CRC

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant lentiviral particles expressing a custom-made 29-mer short hairpin (sh) RNA against ASPP2κ were produced and transduced into the CRC cells according to the manufacturer’s protocols. Empty vector (EV) strains served as controls.
Briefly, a pre-selected custom synthesized lentiviral construct was designed (pGFP-C-shLenti vector; Origene) containing a shRNA expression cassette against ASPP2κ, driven by an U6 promoter, a puromycin resistance marker, driven by a SV40 promoter and a tGFP, driven by a CMV promoter. HEK293T cells were lipofected (Lipofectamine 2000; Thermo Fisher) for lentiviral particle production following the manufacturer’s protocol (packaging mix, Dharmacon). The lentiviral particles were used to transduce HCT116 or DLD-1 cells to induce stable hairpin expression against ASPP2κ. The transduction efficiency was evaluated determining GFP expression, while puromycin was used as a selection marker.
+ Open protocol
+ Expand
10

Stable Cebpg Knockdown in 50B11 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable knockdown of Cebpg in 50B11 cells was done by transfecting 50B11 cells with pGFP-C-shLenti carrying shRNA against Cebpg (1μg/ml; TL709448; Origene, Rockville, MD) following the manufacturer’s recommendations. A 29-mer scrambled shRNA cassette in the pGFP-C-shLenti vector (TR30021; Origene) was used as the off-target control. Transduced cells then underwent puromycin selection and visible confirmation for GFP. Cebpg knockdown efficiency compared to control was verified by Western blot (Online Resource 3).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!