Anti rac2

For immunoblotting, cells were lysed with 1xSDS lysis buffer (1% SDS and 60 mM Tris-HCl pH6.8) and sonicated for 20 seconds. Sixty μg of lysates were then applied to SDS-PAGE for immunoblot analysis. The target proteins were detected by their specific antibodies, including anti-HA (Santa Cruz), anti-Rac1 (BD Biosciences), anti-Rac2, anti-Rac3 (Abcam), anti-phospho-STAT3 Tyr705, anti-STAT3, anti-phospho-ERK1/2 Thr202/Tyr204, anti-ERK1/2, anti-Sox2 (Cell Signaling), anti-CD133 (Proteintech), anti-HIF-2α and anti-VEGF (Novas).
For RT-PCR, cells were subjected to RNA extraction using Trizol^® (Invitrogen) according to the manufacturer's instructions. Two μg of total RNA were reverse transcribed by GoScript™ kit (Promega) and then 2 μl of cDNA were used for PCR reaction by GoTaq^®Green Master Mix (Promega). Forward primer sequence for detecting Rac1-3 is 5’- CCTGAGGTGCGGCACCACTG −3’, and reverse primer sequences for Rac1-3 are 5’- GCAGGCATTTTCTCTTCC-3’, 5’-GGCTGCAGGC GCGCTTCTG-3’, and 5’-CGGTGCACTTCTTCCCC GG-3’, respectively.

Cells were lysed using RIPA buffer (Beyotime, Nantong, China). Samples were sonicated and centrifuged at 13,523 × g for 15 min at 4 °C. The total protein concentration was determined by using a DC Protein Assay Kit (Bio-Rad, Richmond, CA, USA). Samples were denatured at 100 °C for 5 min, separated using SDS-polyacrylmide gel electrophoresis, and transferred to polyvinylidene difluoride membranes (GE Healthcare, Piscataway, NJ, USA). After blockage with PBST containing 5% skimmed milk for 1 h, the membrane was incubated with primary antibodies for 2 h at room temperature, washed three times with PBST for 5 min each, and then incubated with horseradish peroxidase-conjugated secondary antibody for 1 h and washed three times with PBST. Protein bands were visualized using an ECL kit (Millipore, Billerica, MA, USA). Anti-RAC2 was purchased from Abcam (Cambridge, MA, USA) and anti-GAPDH was from Cell Signaling Technology (Beverly, MA, USA). All blottings derived from the same experiment and were processed in parallel. The uncropped images of all blots are shown in Supplementary Fig. 1.

Cells were lysed using RIPA buffer (Beyotime, Nantong, China). Samples were sonicated and centrifuged at 12000 rpm for 15 min at 4°C. The total protein concentration was determined by using a DC Protein Assay Kit (Bio-Rad, Richmond, CA, USA). Samples were denatured at 100°C for 5 min, separated using SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membranes (GE Healthcare, Piscataway, NJ, USA). After blockage with PBST (PBS with 0.1% Tween-20) containing 5% skimmed milk for 1 h, the membrane was incubated with primary antibodies for 2 h at room temperature, washed three times with PBST for 5 min each, and then incubated with HRP-conjugated secondary antibody for 1 h and washed three times with PBST. Protein bands were visualized using an ECL kit (Millipore, Billerica, MA, USA) Anti-RAC2 was purchased from Abcam (Cambridge, MA, USA), and anti-GAPDH was from Cell Signaling Technology (Beverly, MA, USA).