Total RNA was isolated from approximately 10 million LCLs (both LCL#1 and LCL#89) either left untreated (DMSO control) or treated with 1 μM MG132 for 12 h using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Thermo Fisher Scientific Inc., Waltham, MA, USA), followed by cDNA preparation using iScript cDNA synthesis kit (BIO-RAD, Hercules, CA, USA) as per manufacturer’s protocol. RNA and cDNA quality and quantity were checked using Synergy H1 Multimode Microplate Reader (BioTek Instruments, Inc., VT, USA). qPCR analysis was performed using iTaq Universal SYBR Green Supermix (BIO-RAD, Hercules, CA, USA) in CFX Connect Real-Time PCR detection System (BIO-RAD, Hercules, CA, USA) with the following thermal profile– 1 cycle: 95°C for 10 min; 40 cycles: 95°C for 15 sec followed by 60°C for 1 min; and finally the dissociation curve at– 95°C for 1 min, 55°C 30 min, and 95°C for 30 sec. Unless and otherwise stated, each sample was performed in duplicate and calculation was made using a 2−ΔΔCT method to quantify relative expression compared with housekeeping gene controls–B2M, GAPDH and RPLPO. The real time PCR primers used in this study were designed from Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and listed in S2 Table . Real-time PCR primers were obtained from Integrated DNA Technologies, Inc. (Coralville, IA, USA).
Real time pcr primers
Manufactured by Integrated DNA Technologies
Sourced in United States
Real-time PCR primers are short, synthetic DNA sequences designed for use in real-time polymerase chain reaction (PCR) experiments. These primers are used to amplify and detect specific DNA or RNA targets in a sample, allowing for quantitative analysis of gene expression or the presence of specific genetic sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Synergy h1 multi mode microplate reader, by Agilent Technologies (3 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (3 mentions)
Itaq universal sybr green supermix, by Bio-Rad (2 mentions)
Collagenase, by Merck Group (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
Trypsin inhibitor, by Merck Group (1 mentions)
Collagen, by Merck Group (1 mentions)
Fetal calf serum (fcs), by Merck Group (1 mentions)
Insulin, by Thermo Fisher Scientific (1 mentions)
Sybr green supermix, by Thermo Fisher Scientific (1 mentions)
Hepes sodium salt, by Merck Group (1 mentions)
Dme media, by Thermo Fisher Scientific (1 mentions)
Metformin hcl, by Merck Group (1 mentions)
Percoll gradient, by Merck Group (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Ssofast evagreen supermix, by Bio-Rad (1 mentions)
5 protocols using real time pcr primers
1
Quantifying Gene Expression in LCLs
2
Isolation and Culture of Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Metformin HCl (>97% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA).
Nicotinamide adenine dinucleotide phosphate tetrasodium (NADPH), P407, fetal calf serum, collagenase, trypsin inhibitor, Percoll gradient, collagen, HEPES sodium salt, bovine serum albumin (BSA) and other general laboratory chemicals were purchased from Sigma-Aldrich (St.
Louis, MO). Penicillin-streptomycin, insulin, dexamethasone phosphate, DME media, and trypsin were obtained from GIBCO, Invitrogen Corporation (Carlsbad, CA, USA). Heparin sodium injection, 1000 U/mL and 10000 U/mL, were obtained from Leo Pharma Inc. (Thornhill, ON, Canada). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA). High-Capacity cDNA Reverse Transcription Kit, SYBR Green SuperMix were purchased from Applied Biosystems (Foster City, CA). Real-time PCR primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) according to previously published sequences.
Nicotinamide adenine dinucleotide phosphate tetrasodium (NADPH), P407, fetal calf serum, collagenase, trypsin inhibitor, Percoll gradient, collagen, HEPES sodium salt, bovine serum albumin (BSA) and other general laboratory chemicals were purchased from Sigma-Aldrich (St.
Louis, MO). Penicillin-streptomycin, insulin, dexamethasone phosphate, DME media, and trypsin were obtained from GIBCO, Invitrogen Corporation (Carlsbad, CA, USA). Heparin sodium injection, 1000 U/mL and 10000 U/mL, were obtained from Leo Pharma Inc. (Thornhill, ON, Canada). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA). High-Capacity cDNA Reverse Transcription Kit, SYBR Green SuperMix were purchased from Applied Biosystems (Foster City, CA). Real-time PCR primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) according to previously published sequences.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from approximately 10 million cells using TRIzol reagent according to the manufacturer’s instructions (Invitrogen Inc., CA), followed by cDNA preparation using iScript cDNA synthesis kit (BIO-RAD, Hercules, CA) as per manufacturer’s protocol. RNA and cDNA quality and quantity was measured using Synergy™ H1 Multimode Microplate Reader (BioTek Instruments, Inc., VT, USA). qPCR analysis was performed using SsoFast EvaGreen Supermix (BIO-RAD, Hercules, CA) in CFX Connect™ real-time PCR detection system (BIO-RAD, Hercules, CA) with the following thermal profile—1 cycle: 95 °C for 10 min; 40 cycles: 95 °C for 15 s followed by 60 °C for 1 min; and finally the dissociation curve at – 95 °C for 1 min, 55 °C 30 min, and 95 °C for 30 s. Unless and otherwise stated, each sample was performed in duplicate and calculation was made using a 2−ΔΔCT method to quantify relative expression compared with housekeeping gene control. The relative change in the gene expression levels compared to control sample (untreated) was represented as heat map diagram. The primers used in this study were designed from qPrimerDepot (https://primerdepot.nci.nih.gov/ ) and listed in Tables S1 and S2. Real-time PCR primers were obtained from Integrated DNA Technologies, Inc. (Coralville, IA, USA).
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Direct-zol RNA Miniprep Plus Kit according to manufacturer’s protocol. Total 1 μg/sample RNA was subjected to cDNA synthesis using the iScript™ cDNA Synthesis Kit (Biorad). The primers used were designed using primer 3 online tools (http://bioinfo.ut.ee/primer3-0.4.0/primer3/ ) and were obtained from Integrated DNA Technologies (Coralville, Iowa). Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using an iCycler (Biorad laboratories). All reactions were performed in triplicates. The fold expression was calculated and normalized to the average CT value of HPRT housekeeping gene. The real-time PCR primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA). Primer sequences were as follows: APE1 (Forward: GCTTCGAGCCTGGATTAAGA; Reverse: TTGGTCTCTTGAAGGCACAGT), YAP1 (Forward: GATGAACTCGGCTTCAGGTC; Reverse: TTGGGTCTAGCCAAGAGGTG), CTGF (Forward: TGGAGATTTTGGGAGTACGG; Reverse: CAGGCTAGAGAAGCAGAGCC), CYR61 (Forward: CCCGTTTTGGTAGATTCTGG; Reverse: GCTGGAATGCAACTTCGG), ANKRD1 (Forward: AGCCCTCATGCTTGCTGTAT; Reverse: TTTGTTCATGAATGTGATGAAATC), HPRT (Forward: ACCCTTTCCAAATCCTCAGC; Reverse: GTTATGGCGACCCGCAG).
5
RNA Isolation and qPCR Analysis of LCLs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from approximately 10 million LCLs (both LCL#1 and LCL#89) either left untreated (DMSO control) or treated with 1 μM MG132 for 12 h using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Thermo Fisher Scientific Inc., Waltham, MA, USA), followed by cDNA preparation using iScript cDNA synthesis kit (BIO-RAD, Hercules, CA, USA) as per manufacturer’s protocol. RNA and cDNA quality and quantity were checked using Synergy H1 Multimode Microplate Reader (BioTek Instruments, Inc., VT, USA). qPCR analysis was performed using iTaq Universal SYBR Green Supermix (BIO-RAD, Hercules, CA, USA) in CFX Connect Real-Time PCR detection System (BIO-RAD, Hercules, CA, USA) with the following thermal profile– 1 cycle: 95°C for 10 min; 40 cycles: 95°C for 15 sec followed by 60°C for 1 min; and finally the dissociation curve at– 95°C for 1 min, 55°C 30 min, and 95°C for 30 sec. Unless and otherwise stated, each sample was performed in duplicate and calculation was made using a 2−ΔΔCT method to quantify relative expression compared with housekeeping gene controls–B2M, GAPDH and RPLPO. The real time PCR primers used in this study were designed from Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and listed in S2 Table . Real-time PCR primers were obtained from Integrated DNA Technologies, Inc. (Coralville, IA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!