Log In Sign up
The largest database of trusted experimental protocols

Sirna oligonucleotides

Manufactured by Integrated DNA Technologies
Visit Supplier
Sourced in Israel, United States

SiRNA oligonucleotides are short, double-stranded RNA molecules designed to mediate RNA interference (RNAi) by silencing the expression of specific genes. They function by binding to and degrading the target mRNA, thereby preventing the production of the corresponding protein.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Metafectene reagent, by Biontex (1 mentions)

4 protocols using sirna oligonucleotides

1

siRNA Knockdown of RHAMM in SN12L1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA oligonucleotides were purchased from Integrated DNA Technologies (Skokie, IL). SN12L1 cells were seeded at a density of 2.4 × 106 cells in six-well plates, grown for 24 h, and transfected with siRNA oligos targeting RHAMM (siRHAMM) using Lipofectamine RNAiMAX (ThermoFisher, Waltham, MA) according to the manufacturer’s instructions. As a negative control, cells were transfected with scrambled RNA oligos. siRHAMM oligos were: 5′-GUCAAGAAUCAUGGAAGUAAACATC3′ and 3′CACAGUUCUUAGUACCUUCAUUUGUAG-5′.
Moran H., Cancel L.M., Huang P., Roberge S., Xu T., Tarbell J.M, & Munn L.L. (2022). Glycocalyx mechanotransduction mechanisms are involved in renal cancer metastasis. Matrix Biology Plus, 13, 100100.
+ Open protocol
+ Expand
2

siRNA Knockdown of Cell Cycle Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following siRNA oligonucleotides targeting HRP‐3,28, 29E2F1, and Cyclin E were synthesized by Integrated DNA Technologies Inc: siHRP‐3, 5′‐GGCCAUGUGUAAAGUUUAAUU‐3′; siE2F1, 5′‐GUCACGCUAUGAGACCUCACUG‐3′; and siCyclin E, 5′‐AAGUGCUACUGCCGCAGUAUCC‐3′. The siRNA duplexes were transfected into cells using Metafectene reagent (Biontex) according to the manufacturer's guidelines.
Yun H.S., Lee J., Kim J., Sim Y., Lee C., Park J.K., Kim J., Ahn J., Song J., Baek J, & Hwang S. (2021). A novel function of HRP‐3 in regulating cell cycle progression via the HDAC–E2F1–Cyclin E pathway in lung cancer. Cancer Science, 113(1), 145-155.
+ Open protocol
+ Expand
3

Targeted siRNA Oligonucleotide Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA oligonucleotides targeting Mdm20, Nat5 and Rictor were chemically synthesized (Integrated DNA Technologies/IDT), and the sequences are shown in S1 Table. Control siRNA was purchased from IDT.
Yasuda K., Takahashi M, & Mori N. (2015). Mdm20 Modulates Actin Remodeling through the mTORC2 Pathway via Its Effect on Rictor Expression. PLoS ONE, 10(11), e0142943.
+ Open protocol
+ Expand
4

Targeted siRNA Knockdown of GFP, RET, and GFRα4

Check if the same lab product or an alternative is used in the 5 most similar protocols
TT cells that were engineered to express GFP were electroporated with siRNA oligonucleotides (Integrated DNA Technologies, Coralville, IA, USA) targeting GFP (positive control), RET, GFRα4, or with a non-targeting siRNA (negative control). Twenty-four hours later, cells were lysed, and mRNA was isolated for measurement of RET and GFRα4 by qPCR. Cells were also maintained in culture and counted 7 days later to assess proliferation.
Bhoj V.G., Li L., Parvathaneni K., Zhang Z., Kacir S., Arhontoulis D., Zhou K., McGettigan-Croce B., Nunez-Cruz S., Gulendran G., Boesteanu A.C., Johnson L., Feldman M.D., Radaelli E., Mansfield K., Nasrallah M., Goydel R.S., Peng H., Rader C., Milone M.C, & Siegel D.L. (2021). Adoptive T cell immunotherapy for medullary thyroid carcinoma targeting GDNF family receptor alpha 4. Molecular Therapy Oncolytics, 20, 387-398.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!