Qscript microrna synthesis kit

Total RNA was extracted using the TRI Reagent (Molecular Research Center, Cincinnati, OH, USA) in accordance with the manufacturer’s instructions. cDNA was synthesized from the total RNA (1000 ng) by using the qScript cDNA synthesis kit (Quantabio, Beverly, MA, USA). miRNA cDNA was obtained from the purified total RNA (700 ng) using the qScript microRNA Synthesis Kit (Quantabio). Quantitative polymerase chain reaction (qPCR) for mRNA expression was performed with LightCycler 480 SYBR Green I Master (Roche Diagnostics, Indianapolis, IN, USA) and for miR-210 with PerfeCTa SYBR Green SuperMix, Low ROX (Quantabio), as previously described [19 (link),57 (link)]. Each PCR reaction was performed in duplicate. The PerfeCTa microRNA assay included Universal Primer, miR-210 Primer, and SNORD44 as positive control primers (Quantabio). The expression levels were normalized to beta-actin (ACTB; for mRNA) and ribosomal protein S18 (RPS18; for miRNA). The sequences of primers used for qPCR are listed in Table 3. The threshold cycle (Ct) values of each sample were generated, and the relative expression was calculated as 2^-ΔCt=2^{-(Ct target gene − Ct housekeeping gene)} [58 (link)].

Total RNAs were extracted from HL-1 cells using Illustra RNAspin MiniRNA Isolation Kit and the quality and concentration of RNA were evaluated by photometrical measurement of 260/280 nm. The primers were obtained from Sigma Aldrich. Four hundred nanograms of total RNA was applied for reverse transcription using the qScript microRNA Synthesis Kit (QuantaBio, Beverly, MA, USA) following the manufacturer’s protocol. cDNA was diluted 1:5 in DNase-, RNase-, and protease-free water and 2 μL template was used for PCR. The primer pairs for BNP and GAPDH were used. The sequences for the BNP primers are forward (5′–3′) GCCAGTCTCCAGAGCAATTC and reverse (5′–3′) TCTTTTGTGAGGCCTTGGTC. The sequences for the GAPDH primers are forward (5′–3′) AGGTCGGTGTGAACGGATTTG and reverse (5′–3′) TGTAGACCATGTAGTTGAGGTCA. For qRT-PCR, QuantaBio PerfecTa SYBR Green FastMix ROX was used according to the manufacturer’s procedure. The signals generated by integration of SYBR Green into the amplified DNA were detected in a real-time machine (StepOne Plus Real-Time PCR System, ThermoFisher Scientific, USA). Data were expressed as 2-ΔΔCT relative to GAPDH gene expression.