Dna purification kit

The chromatin immunoprecipitation assay was conducted by a SimpleChiP™ Enzymatic Chromatin IP kit (Cell Signaling Technology, Danvers, MA, USA). In short, cells were cross‐linked by 37% formaldehyde for 15 min at 37°C, used glycine to quench the cross‐linking reaction, and then gathered the cells. The cross‐linked chromatin was digested until a length of around 150–900 bp with the micrococcal nuclease added to the collected cells. The cross‐linked chromatin was then, respectively, incubated with 10 μl of anti‐RUNX2 antibody (Cell Signaling Technology), 1 μl of anti‐IgG antibody (negative control, Cell Signaling Technology), or 10 μl of anti‐histone H3 antibody (positive control, Cell Signaling Technology) overnight at 4°C in rotation and incubated with Protein A/G‐Sepharose for 2 h. Beads were then recovered by centrifugation and washed two times with ChIP Wash Buffer. The antibody/protein/DNA cross‐link complexes were reversed by heating at the temperature of 65°C for 2 h, and DNA Purification Kit was performed to purify the DNA (Cell Signaling Technology, Danvers, MA, USA). Purified DNA was scrutinized by RT‐qPCR with promoter‐specific primers (forward and reverse, respectively): SCD1 Primer 1 (5′‐ CCAGTCAACTCCTCGCACTT‐3′ and 5’‐AAGGCTAGAGCTGGCAACG‐3′), SCD1 primer 2 (5’‐CCATTGTTCGCAGGCGTACC‐3′ and 5′‐ ACATCTCCGTCCCGTCTTCC‐3′).

The SimpleChIP Plus Sonication Chromatin IP Kit (56383, Cell Signalling) was used, following manufacturer’s guidelines. In brief, after resuspension of the chromatin pellet in ChIP lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.0 plus 1 X protease inhibitor cocktail), samples were subjected to fragmentation using a Bioruptor pico sonicator (Diagenode) for 5 cycles (30 s ON and 30 s OFF). 5 μg of sonicated, cross-linked chromatin sample per condition was diluted in a 1:4 ratio in 1X ChIP buffer (Cell Signalling) plus 1X protease inhibitor cocktail (Cell Signalling) and subjected to immunoprecipitation with 2.5 μg H3K27ac antibody (Abcam) overnight at 4 °C with rotation. 30 μl of ChIP-Grade Protein G Magnetic Beads (Cell Signalling) were then added to each IP reaction and incubated for 2 h at 4 °C with rotation, prior to a series of low and high salt washes and elution of antibody-protein-DNA complexes in 1X ChIP Elution Buffer. Enriched chromatin samples were then incubated at 65 °C for 2 h with 40 μg Proteinase K (Cell Signalling) to reverse cross-links prior to purification of DNA using the DNA Purification Kit (Cell Signalling) as per manufacturer’s guidelines. DNA was eluted in 50 μL of elution buffer prior to subsequent qPCR using the Luna Universal qPCR Master Mix kit (New England BioLabs).