The generated cDNA was subjected to qPCR amplification with the CM9600 Sequence Detection System (Bio-Rad Laboratories, Inc.) and QuantiTect™ SYBR Green RT-PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). The cycling conditions for the PCR reaction included an initialization at 96°C for 5 min, followed by 38 cycles of 96°C for 30 sec, and a final extension at 65°C for 45 sec. All measurements were performed in triplicate. To standardize miR-130a expression, U6 was used as an internal control. Therefore, the average Cq values of miR-130a minus the average Cq values of U6 equals the ΔΔCq values, and 2−ΔΔCq indicated the quantitative expression levels of miR-130a (31 (link)). The primer sequences used in the present study included: miR-130a forward, 5′-TTGCGATTCTGTTTTGTGCT-3′ and reverse, 5′-GTGGGGTCCTCAGTGGG-3′; and U6 forward, 5′-CTCGCTTCGGCAGCAC-3′ and reverse, 5′-ACGCTTCACGAATTTGC-3′.
Quantitect sybr green rt pcr master mix
Manufactured by Thermo Fisher Scientific
The QuantiTect™ SYBR Green RT-PCR Master Mix is a ready-to-use solution for real-time reverse transcription-polymerase chain reaction (RT-PCR) analysis. It contains all the necessary components, including a DNA-binding dye, for the quantification of RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using quantitect sybr green rt pcr master mix
1
Quantitative miR-130a Expression Analysis
2
Quantitative Analysis of MYC and BCL2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MYC and BCL2 expressions were detected as previously described by Xia et al., (2015). β-actin was used as a reference gene. Amplification for MYC and BCL-2 were performed in a total volume of 20 μL containing 10μL of kit-supplied QuantiTect™ SYBR® Green RT-PCR Master mix (Applied-Biosystems), 0.4 μL of each primer, 2 μL of cDNA and 7.2 μL ddH2O. Primer pair sequences for the MYC gene were; c-Myc-F: CCTCCACTCGGAAGGACTATC; c-Myc-R: TGTTCGCCTCTTGACATTCTC, for BCL-2 were; BCL2-F; GTGGATGACTGAGTACCTGAACC; BCL-2-R: AGACAGCCAGGAGAAATCAAAC and for β-Actin were β -Actin-F: CCTGGCACCCAGCACAAT; β -Actin-R: GGGCCGGACTCGTCATAC. The PCR cycling parameters were set as follows: 95 C for 30 s followed by 40 cycles of PCR reaction 95 °C for 5 s and 60°C for 34 s. The amplification was carried out using Real-time PCR (StratageneMx3005P-qPCR System). Relative changes in gene expression were calculated using the 2-ΔΔCT method (Livak and Schmittgen 2001).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!