The full-length cheY3 or cheY3* (in cheY3*, Asp79, a key residue required for the phosphorylation, was replaced by Ala (Table 1 )). The cheY3 gene was first amplified by PCR (primers P15/P16) using DNA polymerase (Invitrogen, Carlsbad, CA) with engineered BamHI and SacI cut sites at its 5′ and 3′ ends, respectively. The amplicon was first cloned into the pGEM-T Easy vector (Promega, Madison, WI) and then subcloned into the pQE80 expression vector (Qiagen, Valencia, CA), yielding a vector of pQE80CheY3/CheY3*, which encodes an N-terminal histidine (His) tag. The full-length fliM and fliN genes (stop codon removed) were PCR amplified (primers P17/P18 and P19/P20) using DNA polymerase (Invitrogen, Carlsbad, CA) with engineered SacI at its 5′ end and FLAG tag and SalI cut site at 3′ ends. The amplicons were first cloned into the pGEM-T Easy vector and then digested using SacI and SalI and subcloned into precut pQE80CheY3/CheY3*. The resultant plasmid was then transformed into the BL21 strain that harbors GroEL-GroES chaperones for protein production. The expression of recombinant proteins in E. coli cells was induced with 1 mM isopropyl-β-D-thiogalactoside (IPTG) overnight at 16°C. Recombinant HisCheY or HisCheY* and bound proteins were purified using nickel agarose columns (Qiagen) under native conditions per manufacturers’ instructions.
Dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecules. It plays a crucial role in the process of DNA replication, which is essential for cell division and reproduction. DNA polymerase is responsible for adding complementary nucleotides to a DNA template, forming a new DNA strand that is an exact copy of the original.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (25 mentions)
Restriction enzyme, by Thermo Fisher Scientific (16 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (7 mentions)
Trizol, by Thermo Fisher Scientific (7 mentions)
T4 ligase, by Thermo Fisher Scientific (6 mentions)
Dntps, by Thermo Fisher Scientific (5 mentions)
Pgem t easy vector, by Promega (4 mentions)
Acetonitrile, by Thermo Fisher Scientific (4 mentions)
Mgcl2, by Thermo Fisher Scientific (3 mentions)
Zeocin, by Thermo Fisher Scientific (3 mentions)
Rnase h, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Dna ligase, by Thermo Fisher Scientific (3 mentions)
P pastoris gs115, by Thermo Fisher Scientific (2 mentions)
Kanamycin, by Thermo Fisher Scientific (2 mentions)
Dna marker, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Sybr green, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mixture, by Thermo Fisher Scientific (2 mentions)
71 protocols using dna polymerase
1
Recombinant CheY and FliM/FliN Purification
2
Chikungunya Virus-Like Particles Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA polymerase, restriction enzymes, and T4 DNA ligase were procured from Fermentas (USA). Synthetic oligonucleotides and chemicals were procured from Sigma-Aldrich (USA). The yeast transfer vector pPIC9K was from Invitrogen (USA). The P. pastoris GS115 (Invitrogen, USA) was used as the host strain for expression of the Chikungunya VLPs. P. pastoris GS115 (Invitrogen, USA) was grown at 28°C in Yeast Extract Peptone Dextrose (YPD) Medium. 2% agar was added to the media for plate culture. Transformants were screened in media supplemented with 500 μg/ml Geneticin (Sigma, USA). E. coli DH5α were used in cloning experiments and were grown at 37°C in LB medium supplemented with 100 μg/ml kanamycin.
3
Genetic Manipulation of Thermophilic Microbes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strains of Thermoanaerobacter tengcongensis MB4 (provided by Dr. Ma, Institute of microbiology Chinese academy of sciences), Thermus thermophiles HB8 (China Center of Industrial Culture Collection) S. cerevisiae INVSc1 (MATa his3D1 leu2 trp1-289 ura3-52/MATa his3D1 leu2 trp1-289 ura3-52) (Invitrogen, Carlsbad, CA) and Escherichia coli Top10 (Novagen, USA) were genetically manipulated in this study. LB medium (NaCl 10 g/L, yeast extract 5 g/L, tryptone 10 g/L) with 100 mg/L Kanamycin and YPD medium (glucose 20 g/L, tryptone 20 g/L, yeast extract 10 g/L) with 300 mg/L G418 (Invitrogen, Carlsbad, CA) were used to select E. coli and S. cerevisiae transformants respectively. Plasmid pRS42K was purchased from EUROSCARF, Frankfurt, Germany. Restriction enzymes and DNA polymerase were obtained from Fermentas (Burlington, ON). The primers were synthesized by Sangon Biotech (Shanghai, China).
4
Amplification and Sequencing of Flavobacterium 16S rDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplification of 16S rDNA of biochemically confirmed Flavobacteriumstrains were performed by using universal primers 20F and 1492R (Weisburg et al., 1991 (link)). PCR
amplification was carried in a 50 μL reaction mixture containing: 100 ng of purified
DNA as template, 1xTaq DNA polymerase buffer, 10 mM dNTPs, 1.5 mM
MgCl2, and 0.4 μL of Taq DNA polymerase (MBI
Fermentas) in gradient mastercycler (Eppendorf, Germany). The PCR reaction was
incubated for 2 min denaturation at 95 °C, followed by 30 cycles at 95 °C for 30 s,
annealing at 50 °C for 60 s, and extension at 72 °C for 60 s, with a final extension
step of 10 min at 72 °C. PCR products were analysed by electrophoresis in 1% (w/v)
agarose gel in 1x Tris Acetate- EDTA buffer. PCR products were analyzed at constant
voltage of 7V cm-1 on 1% agarose gel containing (0.5 μg mL-1)
ethidium bromide and DNA marker (Lambda DNA
EcoRI/HindIII marker, Genei Pvt. Ltd, Bangalore,
India). PCR products were gel purified by using the QIAquick Purification Kit
(Qiagen, Limburg, Netherlands) according to the manufacturer's protocol. Purified
amplicons were sequenced bidirectionally with the 27F and 1492R primers.
amplification was carried in a 50 μL reaction mixture containing: 100 ng of purified
DNA as template, 1xTaq DNA polymerase buffer, 10 mM dNTPs, 1.5 mM
MgCl2, and 0.4 μL of Taq DNA polymerase (MBI
Fermentas) in gradient mastercycler (Eppendorf, Germany). The PCR reaction was
incubated for 2 min denaturation at 95 °C, followed by 30 cycles at 95 °C for 30 s,
annealing at 50 °C for 60 s, and extension at 72 °C for 60 s, with a final extension
step of 10 min at 72 °C. PCR products were analysed by electrophoresis in 1% (w/v)
agarose gel in 1x Tris Acetate- EDTA buffer. PCR products were analyzed at constant
voltage of 7V cm-1 on 1% agarose gel containing (0.5 μg mL-1)
ethidium bromide and DNA marker (Lambda DNA
EcoRI/HindIII marker, Genei Pvt. Ltd, Bangalore,
India). PCR products were gel purified by using the QIAquick Purification Kit
(Qiagen, Limburg, Netherlands) according to the manufacturer's protocol. Purified
amplicons were sequenced bidirectionally with the 27F and 1492R primers.
5
Quantitative RT-PCR Analysis of MASPIN in Uveal Melanoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on our qRT-PCR results, the gene expression of MASPIN (SERPINB5) has been further examined in human uveal melanoma and healthy human uvea specimens. The following primer pairs were used: 5′ - GGCAATGTCCTCTTCTCTCC - 3′ (sense), 5′- GCCGCTTGATTAGTTTCAGT - 3′ (antisense) (Sigma-Aldrich Corporation, USA). Primers were designed using Primer3web softwer. 1 μl of the cDNA was amplified in 25 μl solution containing 1.5 mM MgCl2, 1xPCR buffer (Fermentas, Germany), 0.3 mM of each deoxynucleotide (Promega, Germany), 1 unit of DNA polymerase (Fermentas, Germany) and 0.1 μM of each primer. Samples were subjected to an initial denaturation (95°C for 3 min) followed by 35 cycles of amplification (95°C for 45 sec, 60°C for 30 sec, 72°C for 1.5 min) and a final elongation step (72°C for 10 min). As positive control we used HaCaT cDNA samples. No template control (NTC) has been used to detect potential contaminations in the reactions. 10 μl of each amplification reaction was then electrophoretically separated on 1.5% agarose gel, stained with GelRed (Biotinum, USA), and visualized under UV light.
6
Recombinant Protein Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Host strain E. coli BL 21 StarTM (DE3) and vector pET-22b(+) were from Invitrogen (Carlsbad, CA, USA). DNA polymerase, DNA marker, T4 DNA ligase, and restriction endonucleases Nde I and Hind III were from Fermentas (Waltham, MA, USA). A polymerase chain reaction (PCR) amplification kit (including PCR buffer and dNTP mix) was obtained from Takara (Shiga, Japan). The plasmid mini kit I and PCR product recovery kit were purchased from Omega Bio-Tek (Norcross, GA, USA). Uric acid standard was from Sigma-Aldrich (St. Louis, MO, USA). All other reagents were of analytical grade.
7
Recombinant Glucoamylase Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Raw starch degrading glucoamylase gene was used in this study that was previously isolated from A. flavus NSH9 (Karim et al., 2019) (link), and was preserved in the laboratory. The yeast expression vectors pPICZαC, pPICZB, and P. pastoris GS115 yeast strain were purchased from Invitrogen (Carlsbad CA, USA). Escherichia coli XL1-Blue collected from laboratory, pGEMT-Easy vector (Promega, US), DNA polymerase (EURx Gdansk Poland), and restriction endonucleases were purchased from Fermentas (Germany). Zeocin was obtained from Invitrogen. Other reagents were all analytical grade and were obtained from Sigma-Aldrich.
8
RNA-seq Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The poly (A) RNA was isolated from 20 μg of the total RNA pool using Dynal oligo (dT) 25 beads (Invitrogen) according to the manufacturer’s protocol. Following purification, the mRNA was fragmented into smaller pieces at 70 °C for 5 min in the fragmentation buffer (Ambion) and reverse-transcribed to synthesize first strand cDNA using SuperScript III reverse transcriptase (Invitrogen) and N6 random hexamers (Takara). Subsequently, second strand cDNA was synthesized using RNase H (Invitrogen) and DNA polymerase (Invitrogen). These cDNA fragments were further processed by end repair using T4 DNA polymerase, the Klenow fragment of DNA polymerase, and T4 polynucleotide kinase (NEB), and ligation of adaptors with Illumina’s adaptor oligo mix and T4 DNA ligase (Invitrogen). The products were gel purified to obtain DNA approximately 200 bp long using Qiaquick Gel Extraction Kit (Qiagen) and enriched with PCR for preparing the sequencing library. The quality of the cDNA library was examined by Agilent 2100 Bioanalyzer.
9
Recombinant Expression and Antibody Production of FlhF from Borrelia burgdorferi
10
Comparative Citrus NBS Gene Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
Citrus leaf samples were collected from the six Citrus plants in USHRL's (USDA Horticultural Research Laboratory, Fort Pierce, Florida): C. sinensis (sweet, navel orange), C. aurantium (karum jamir, sour orange), C. reticulata (mandarin orange), C. clementina (clementina), C. aurantiifolia (sweet lime), C. japonica (Yuzu, kumquat), and C. maxima (pomelo). Total DNA was extracted from leaf midribs following the Plant Mini Kit standard protocol from Qiagen Inc. (Valencia, CA), followed by DNA quantity and quality evaluation with Nanodrop. We chose the NBS gene, Cs1g09350, which was conserved in C. clementina and C. sinensis for validating the conservation of NBS gene among different Citrus genomes. Primers used in this study were designed using Oligo 7.23 (Molecular Biology Insights, Inc., Cascade, CO, USA). DNA Polymerase (Invitrogen, Carlsbad, CA, USA) was used to amplify the NBS-LRR genes from Citrus DNA. For PCR, 20 μL reactions using standard conditions provided by the manufacturer for DNA Polymerase. PCR was performed using an initial denaturation at 95°C for 3 minutes, 35 cycles of 94°C for 20 seconds, 50–52°C for 20 seconds (specified by different primer sets) and 68°C for 3 minutes, follow by final extension at 68°C for 10 minutes. The cloning and sequencing analysis of amplified PCR products were conducted as previously described [43 (link)]
+ Expand
Citrus leaf samples were collected from the six Citrus plants in USHRL's (USDA Horticultural Research Laboratory, Fort Pierce, Florida): C. sinensis (sweet, navel orange), C. aurantium (karum jamir, sour orange), C. reticulata (mandarin orange), C. clementina (clementina), C. aurantiifolia (sweet lime), C. japonica (Yuzu, kumquat), and C. maxima (pomelo). Total DNA was extracted from leaf midribs following the Plant Mini Kit standard protocol from Qiagen Inc. (Valencia, CA), followed by DNA quantity and quality evaluation with Nanodrop. We chose the NBS gene, Cs1g09350, which was conserved in C. clementina and C. sinensis for validating the conservation of NBS gene among different Citrus genomes. Primers used in this study were designed using Oligo 7.23 (Molecular Biology Insights, Inc., Cascade, CO, USA). DNA Polymerase (Invitrogen, Carlsbad, CA, USA) was used to amplify the NBS-LRR genes from Citrus DNA. For PCR, 20 μL reactions using standard conditions provided by the manufacturer for DNA Polymerase. PCR was performed using an initial denaturation at 95°C for 3 minutes, 35 cycles of 94°C for 20 seconds, 50–52°C for 20 seconds (specified by different primer sets) and 68°C for 3 minutes, follow by final extension at 68°C for 10 minutes. The cloning and sequencing analysis of amplified PCR products were conducted as previously described [43 (link)]
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!