RNA was isolated from colon tissues using an RNeasy Mini kit (Qiagen). cDNA was synthesized with total RNA (1 μg) by SuperScriptⅡ Reverse Transcriptase and oligo (dT) primer (all from Thermo Fisher). The products were used as a template for real-time PCR using SYBR Green qPCR Master Mix (Affymetrix) and primers with the following sequences: Mt1, 5ʹ-TCACCAGATCTCGGAATGG-3ʹ and 5ʹ-AAGAACCGGAATGAATCGC-3ʹ; Mt2, 5ʹ-GCTGCATCTGCAAAGAGGCTT-3ʹ and 5ʹ- TGGAGAACGAGTCAGGGTTGTA-3ʹ; β-actin, 5ʹ- TGGAATCCTGTGGCATCCATGAAAC-3ʹ and 5ʹ- TAAAACGCAGCTCAGTAACAGTCCG-3ʹ. For detection of bacterial 16s rDNA, fecal bacterial DNA from 200 mg of feces and genomic DNA from a known amount of A. muciniphila (BAA-835, ATCC) were extracted by using DNA Stool Mini Kit (Qiagen). Ten-fold serial dilutions of A. muciniphila DNA were used for standard curve generation to quantify bacteria. Real-time PCRs were performed using 1 μl of DNA extract, SYBR Green qPCR Master Mix (Affymetrix), and primers with the following sequences: Universal bacteria 16S rDNA, 5ʹ-ACTCCTACGGGAGGCAGCAG-3ʹ and 5ʹ-ATTACCGCGGCTGCTGG-3ʹ; A. muciniphila 16S rDNA, 5ʹ- CAGCACGTGAAGGTGGGGAC-3ʹ and 5ʹ-CCTTGCGGTTGGCTTCAGAT-3ʹ. The 16S rDNA copy numbers for fecal samples were calculated by interpolating CT values in the standard curve.
Sybr green qpcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Germany, Canada, United Kingdom, Lithuania, Belgium, Singapore, Switzerland
The SYBR Green qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) that contains the necessary components for amplification and detection of target DNA sequences, including the SYBR Green I dye for fluorescent detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (136 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (62 mentions)
Trizol, by Thermo Fisher Scientific (56 mentions)
Rneasy mini kit, by Qiagen (45 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (36 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (20 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (18 mentions)
Nanodrop, by Thermo Fisher Scientific (16 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (10 mentions)
Rneasy kit, by Qiagen (10 mentions)
Primescript rt reagent kit, by Takara Bio (10 mentions)
Dnase 1, by Thermo Fisher Scientific (9 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (9 mentions)
Cfx96 real time system, by Bio-Rad (9 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (9 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (8 mentions)
Cfx384 real time system, by Bio-Rad (7 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (7 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (7 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
469 protocols using sybr green qpcr master mix
1
Quantification of Intestinal Microbiota and Gene Expression
2
Real-time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA concentrations were measured by nanodrop and single-stranded complementary DNA (cDNA) was performed from 1 μg of total RNA using cDNA synthesis kit (RevertAid First Strand cDNA Synthesis Kit; Thermo Scientific, Waltham, MA, USA) as previously described (Bozkurt., et al. 2019). Real-time PCR experiment was performed using the Stratagene MX3000P System (Stratagene MX3000P, La Jolla, CA, USA) and SYBR Green QPCR Master Mix (Maxima SYBR Green QPCR Master Mix (2X); Thermo Scientific).
The reaction mixture contained 1 μL of cDNA template, 12.5 μL of SYBR Green QPCR Master Mix, 0.5 μL each of the forward and reverse primers (10 mM), molecular grade water that was added to make up the final volume to 25 μL. Each reaction was performed in three replicate samples. Glyceraldehde-3-phosphate dehydrogenase (GAPDH) gene was used as the house keeping gene. Subsequently, the specificity of PCR amplifications were confirmed with the melting curve analysis of software associated with Stratagene MX3000P System. Relative gene expression levels were evaluated using the 2-ΔΔCT method [26] . The primer sequences for
The reaction mixture contained 1 μL of cDNA template, 12.5 μL of SYBR Green QPCR Master Mix, 0.5 μL each of the forward and reverse primers (10 mM), molecular grade water that was added to make up the final volume to 25 μL. Each reaction was performed in three replicate samples. Glyceraldehde-3-phosphate dehydrogenase (GAPDH) gene was used as the house keeping gene. Subsequently, the specificity of PCR amplifications were confirmed with the melting curve analysis of software associated with Stratagene MX3000P System. Relative gene expression levels were evaluated using the 2-ΔΔCT method [26] . The primer sequences for
3
ChIP-seq Data Analysis Pipeline
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-seq experiments were performed as previously described [61] (link). ChIP-seq data are available at the Gene Expression Omnibus (GEO) (accession number GSE55912).Tags were aligned to the human genome (hg18 assembly) using Bowtie version 0.12.7 [62] (link) with default parameters except “-S -m 1”. Peak detection for JMJD3 and p53 datasets was performed in MACS version 2 [63] (link), using sequencing reads from an IgG control experiment as negative control. When generating bigwig files we allowed only one read per chromosomal position thus eliminating potential spurious spikes. Each remaining read was extended from its 5′-end to a total length of 250 bases. Each bigwig file was also scaled to TPM (Tags Per Million) based on the number of unique read positions. Heat map and binding profiles across genomic regions were generated using the SeqMiner program [64] (link), where a constant read number between samples was employed for comparison. Gene Ontology classifications were performed using the Panther program [65] (link). Primers for ChIP-qPCR analyses were designed using the Primer3 software and real-time quantitative PCR was performed on a Roche LightCycler 480 II detection system using SYBR Green qPCR Master Mix (Fermentas).
4
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equal quantity of purified RNA was obtained from neutrophils, leukocytes, and brain tissues and used as a template for cDNA synthesis using SYBR Green qPCR Master Mix (Fermentas), oligo‐d(T) primers, and SuperScript III/RNaseOUT Enzyme Mix (Invitrogen). miR‐29b primer sequences for human neutrophils were 5′‐GGGTAGCACCATTTGAAATCA‐3′ and 5′‐GTGCGTGTCGTGGAGTCG‐3′. MiR‐29b primer sequences for rat leukocytes were 5′‐CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG‐3′ and 5′‐ACACTCCAGCTGGGTAGCACCATTTGAAATC‐3′. H19 primer sequences for human neutrophils were 5′‐CTTCTTTAAGTCCGTCTCGTTC‐3′ and 5′‐GAGGCAGGTAGTGTAGTGGTTC‐3′. H19 primer sequences for rats 5′‐GGAATCGGCTCGAAGGTAAA‐3′ and 5′‐GGGCCAGGCAGAGTTAGTTG‐3′. C1QTNF6 primers for human neutrophils were 5′‐TCAGTCCCTTCCACCAAA‐3′ and 5′‐ACCTTGATAAAGCCTGGAGA‐3′. C1QTNF6 primer sequences for rats were 5′‐GTTCGGGGTCTGTGAGTTGAG‐3′ and 5′‐CTTTCAGGATGGTGATGTTGATGTA‐3′. The relative gene expression was calculated using the 2−ΔΔCT method, normalized, and expressed as fold change relative to U6.
5
Quantifying Stress-Induced Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Matched seed sets were germinated on Gamborg’s B5 medium, with or without 1 μM (+)-ABA. Total seed RNA was extracted using the E.Z.N.A. Plant RNA Kit (cat#R6827-01, Omega Bio-Tek) according to the manufacturer’s instructions for difficult samples. Genomic DNA was digested during RNA extraction by treating the columns with DNase (cat#E1091. Omega Bio-Tek). First-strand cDNA was synthesized using the SuperScript III First-Strand Synthesis System (cat#18080-051, Invitrogen). qPCR was performed using a CFX Connect™ Real-Time PCR Detection System (Bio-Rad) with the SYBR Green qPCR Master Mix (cat#K0222, Fermentas). Gene expression analysis was done using the CFX Manager™ software (Bio-Rad). Normalized expression, ∆∆Cq, was selected as the analysis mode. Samples were normalized to a constitutively expressed reference gene, At2g32170 (Czechowski et al. 2005 (link)). Three biological replicates were used for the qPCR, which was repeated three times with the same results. Statistical analysis was done with two-way ANOVA (P < 0.05), in which genotype and seed growth media were used as the two variables, followed by Bonferroni multiple comparisons post hoc test against Col-0 on B5 media or on B5+1 μM ABA (Gutierrez et al. 2008 (link); Rieu and Powers 2009 (link)). Primer sequences are available upon request.
6
RNA Interference in Mosquitoes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1 ~ 2-day-old cold-anesthetized mosquitoes were injected into the thorax with dsRNAs by using a nano-injector (Nanoliter 2000, WPI, Sarasota, Florida, USA). 1 μg of dsRNAs was injected for better silencing efficiency of the AaOr8 and AaOr49 target genes35 (link). The same amount of GFP dsRNAs was used for control dsRNA injection. The gene silencing effect was verified using quantitative real-time PCR (qRT-PCR). Total RNAs were extracted from injected mosquitoes as described above. 1 μg of RNA was used for cDNA synthesis, using the superscripttm III (Invitrogen, Grand Island, NY, USA). qRT-PCR was conducted with the StepOnePlus (Applied Biosystems, CA, USA) using SYBR green qPCR Master Mix (Fermentas, Ontario, Canada) with gene-specific primers (Table S1). Quantitative analysis of the gene silencing capacity was assessed by employing a StepOne plus Software V2.0 (Applied Biosystems). Analyzed results were normalized to the validated control gene, rps7 gene of Ae. aegypti, using the ΔΔCt method36 (link).
7
miRNA Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA cDNAs were synthesized from total RNA using miRNA-specific stem-loop primers (Supplementary Table 2 ) according to previously described criteria56 (link). Expression of the mature miRNA was analyzed by qPCR as described previously57 (link). Briefly, cDNA was diluted 10 times and added into a qPCR reaction mixture with a final volume of 20 µL, containing 2× SYBR Green qPCR Master Mix (Fermentas), 0.5 µM each of forward and reverse primers, 1 μL of cDNA, and 7 μL of ddH2O. The qPCR was performed with the following program: 94 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Expression of let-7a, a miRNA normally expressed in most insect cells, was used as a positive control.
8
Quantitative analysis of gene expression in co-cultured HUVECs and glioma spheroids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from co-cultured HUVECs with encapsulated glioma spheroids in fibrin gel using an RNA Purification Kit (GeneJETTM Fermentas, Hungary), followed by treatment with a first strand cDNA Synthesis Kit for RT-qPCR (RevertAid, Thermo, Hungary). The purified RNA was reverse transcribed using SYBR Green qPCR Master Mix (Fermentas). Quantitative real-time PCR was performed using the kit according to the manufacturer’s instructions and the real time QRT-PCR of each cDNA sample was repeated in two individual runs, and the data from two separate experiments was taken for statistical analysis. The primers were designed using Primer 3 software and synthesized by Takara Biotechnology, and are listed in Table 1 .
9
Quantification of α-SMA mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from LX-2 cells using Trizol Reagent (Invitrogen) and quantified. RNA was synthesized from 1 μg of total RNA using cDNA Reverse Transcription kit (Invitrogen). Real-time PCR was performed using the Mastercycler ep realplex 4 real-time PCR system (Eppendorf) with an SYBR Green qPCR Master Mix (Fermentas) according to the manufacturer's protocol. The sequences of primers for human α-SMA (NC_000010.11) were 5′-CCACCGCAAATGCTTCTAAGT-3′ (forward) and 5′-GGCAGGAATGATTTGGAAAGG-3′ (reverse). The primers for human GAPDH (NM_002046.3) were 5′-TGCACCACCAACTGCTT AGC-3′ (forward) and 5′-GGCATGGACTGTGGTCATGAG-3′ (reverse). The amplification conditions were as follows: 951C for 10 min, and 40 cycles of 951C for 15 s, 641C for 30 s and 721C 20 s. The amount of α-SMA transcripts of individual samples was normalized to GAPDH.
10
Grape and Arabidopsis Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ‘ Kyoho’ skin of 2, 4, 6, 8 days after infected by Agrobacterium containing OE and VC were used to detect hygromycin gene. The berry skins at 40, 80 and 120 days after anthesis of black and white spine grape were used to identify candidate genes57 (link). The RNA was extracted using TIANGEN RNAprep Pure Plant Kit (Tiangen Biotech). The four-week-old leaf of Arabidopsis was used to screen positive plants. The RNA was isolated from samples using TRIzol reagent (Invitrogen). Genomic DNA was removed by DNaseI (Thermo Scientific). The first-strand complementary DNA (cDNA) synthesis was performed with a RevertAid First-Strand cDNA Synthesis Kit (Thermo Scientific). qRT-PCR was performed in the presence of SYBR green qPCR Master Mix (Fermentas) and the amplification was performed in the Eco Real-Time PCR system (Illumina). All reactions were performed in triplicate58 (link). The primers were designed using Oligo 7.0 and are listed in the Supplementary Table S9. The VlActin and VdActin were used as internal controls for grape. AtUBQ3 was used as internal controls for Arabidopsis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!