Dulbecco’s Modified Eagle Medium (DMEM) was purchased from Gibco (Grand Island, NY, USA). Fetal bovine serum (FBS) was purchased from Thermo Scientific (Waltham, MA, USA). Modified radioimmunoprecipitation assay (RIPA) lysis buffer, protease inhibitor cocktail, Coomassie Plus™ Protein Assay Reagent, and chemiluminescent immunoblotting reagent were obtained from Thermo Fisher Scientific (Rockford, IL, USA). QIAzol lysis reagent was purchased from Qiagen (Valencia, CA, USA). ReverTra Ace® qPCR Master Mix was purchased from Toyobo Co., Ltd. (Osaka, Japan). SensiFASTTM SYBR® Lo-ROX Kit was purchased from Meridian Bioscience® (Cincinnati, OH, USA). The MTT or 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye and mouse anti-β-actin primary antibody were purchased from Sigma-Aldrich Company (St. Louis, MO, USA). Anti-NLRP3 primary antibody, anti-ASC primary antibody, anti-caspase-1 primary antibody, anti-NF-κB primary antibody, anti-PARP primary antibody, and goat horseradish peroxidase-conjugated anti-mouse- or anti-rabbit-IgG were obtained from Cell Signaling Technology company (Danvers, MA, USA).
Sensifast sybr lo rox kit
Manufactured by Meridian Bioscience
Sourced in United Kingdom, United States, Germany, Australia, Singapore
The SensiFAST SYBR Lo-ROX Kit is a ready-to-use kit designed for real-time PCR. It contains all the necessary components, including SYBR Green I dye, to perform sensitive and reliable quantitative PCR (qPCR) reactions.
Automatically generated - may contain errors
Lab products found in correlation
Sensifast cdna synthesis kit, by Meridian Bioscience (33 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (26 mentions)
Trizol, by Thermo Fisher Scientific (23 mentions)
Trizol reagent, by Thermo Fisher Scientific (21 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (16 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (15 mentions)
Rneasy mini kit, by Qiagen (13 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (13 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (8 mentions)
Tri reagent, by Merck Group (7 mentions)
Tetro cdna synthesis kit, by Meridian Bioscience (7 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (7 mentions)
Dulbecco s modified eagle medium dmem, by Thermo Fisher Scientific (6 mentions)
Revertra ace qpcr master mix, by Toyobo (6 mentions)
Allprep dna rna ffpe kit, by Qiagen (6 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (6 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (6 mentions)
Trisure, by Meridian Bioscience (6 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
202 protocols using sensifast sybr lo rox kit
1
Molecular Mechanisms of NLRP3 Inflammasome Activation
2
SARS-CoV-2 Spike Protein Activation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco’s Modified Eagle Medium (DMEM) was purchased from Gibco (Grand Island, NY, USA). Roswell Park Memorial Institute (RPMI)–1640 medium (R8758, Sigma-Aldrich), Cyanidin-3-O-glucoside (C3G), peonidin-3-O-glucoside (P3G), phorbol 12-myristate 13-acetate (PMA), and anti b-actin were purchased from Sigma-Aldrich (St. Louis, MO, USA). Fetal bovine serum (FBS) was purchased from Thermo Scientific (Waltham, MA, USA). Recombinant human coronavirus SARS-CoV-2 Spike Glycoprotein S1 (Active) (ab273068) was purchased from Abcam (Cambridge, UK). TRI reagent® was purchased from Merck Millipore (Billerica, MA, USA). ReverTra Ace® qPCR Master Mix was purchased from Toyobo Co., Ltd. (Osaka, Japan). SensiFASTTM SYBR® Lo-ROX Kit was purchased from Meridian Bioscience® (Cincinnati, OH, USA). The anti-NLRP3, anti-ASC, anti-caspase-1, primary antibody, and horseradish peroxidase-conjugated anti-mouse- or anti-rabbit-IgG were purchased from Cell Signaling Technology (Danvers, MA, USA).
3
Analyzing Wnt Signaling in DP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from DP cells using TRIzol™ Reagent (Invitrogen; Thermo Fisher Scientific), and cDNA was synthesized using reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific). For real-time PCR, QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) was used. Total reaction volume of 20 μL contained 1-μL cDNA, 500 nM of each primer, and 10-μL SensiFAST™ SYBR Lo-ROX Kit (Bioline, Taunton, MA, USA). Samples were analyzed in triplicate, and β-actin was used as an internal control to normalize the relative quantity of gene expression. For PCR, total volume of 50 μL contained 1-μL cDNA, 200 nM of each primer, Dream Taq DNA Polymerase and Dream Taq buffer (Thermo Fisher Scientific) for 35 cycles. The following primer pairs were used: Wnt3a, 5′-AGTGCAAATGCCACGGACTA-3′ (forward), 5′-TTGGGCTCGCAGAAGTTAGG-3′ (reverse); Wnt7a, 5′-CAGAATGCCCGAACCCTCAT-3′ (forward), 5′-TAGCCT GAGGGGCTGTCTTA-3′ (reverse); β-catenin, 5′-CCATCACCACGCTGCATAAT-3′ (forward), 5′-GAGCAGACAGACAGCACCTT-3′ (reverse); Lef1, 5′-GGCATC CCTCATCCAGCAAT-3′ (forward), 5′-GTTGATAGCTGCGCTCTCCT-3′ (reverse); Gsk3b, 5′-AGAACCACCTCCTTTGCGGA-3′ (forward), 5′-GTGGTTACCTTGCTGCCATCT-3′ (reverse); Fzd7, 5′-GGTGGATGGTGACCTACTCA-3′ (forward), 5′-GCTCGTAAAAGTAGCACGCC-3′ (reverse); and β-actin, 5′-AAGATCCTGACCGA GCGTGG-3′ (forward), 5′-CCGCTCATTGCCGATAGTG-3′ (reverse).
4
Reverse Transcription and qPCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIZol (Thermo Fisher), and reverse transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher), as previously described [39 (link)]. PCR was conducted on a Roche Lightcycler 480 machine using SensiFAST™ SYBR Lo-ROX Kit (Bioline). Primer sets used for PCR were human PFKFB3 F-CAGTTGTGGCCTCCAATATC, R-GGCTTCATAGCAACTGATCC [40 (link)]; human β-ACTIN F-CATGTACGTTGCTATCCAGGC, R- CTCCTTAATGTCACGCACGAT [41 (link)].
5
Reverse Transcription and Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For reverse transcription (RT) reactions, PCR was performed with 800 ng of total RNA prepared with 1 μL of random primer. The sample was denatured at 65°C for 5 min, and then, the temperature dropped to 4°C before 4 μL of a 10 mM dNTP mixture and 1 μL of reverse transcriptase were added with 1 μL RNase inhibitor (20 U/μL) and 4 μL 5 × RT buffer (250 mM Tris-HCl, pH = 8.3, 375 mM KCl, and 15 mM MgCl2). PCR was performed at 25°C for 10 min, at 42.5°C for 60 min, and at 70°C for 10 min. RT-PCR (Bio-Rad, USA) was performed using synthesized cDNA, forward/reverse primers, and SensiFAST SYBR Lo-Rox Kit (Bioline, England). The sequences of primers used in the experiment are presented in Table 2 . The forward/reverse primer mixture (2 μL at 3 μM) was combined with 7.5 μL SYBR, 4.5 μL DW, and 1 μL cDNA. In addition, predenaturation was performed for 40 cycles at 5 min each at 95°C, 40 cycles at 95°C, and 1 min at 60°C. The Cq values were calculated.
6
Intestinal Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Intestinal tissues were collected and immediately stored in RNALater (Life Technologies). After removal of the RNALater, the tissues were homogenized using Trizol (Life Technologies) and 1.0-mm silicon carbide beads (Biospec Products) on the Precellys 24 at 4000 rpm for 30 s, three times. After centrifugation, the supernatant was collected and RNA extraction performed using a Direct-zol RNA purification kit (Zymo Research). cDNA was synthesized from tissue RNA (Sensifast cDNA synthesis kit, Bioline) and real-time PCR used the SensiFast SYBR Lo-ROX Kit (Bioline) on a ViiA7 real-time PCR system (Life Technologies). Data were analyzed in duplicates using the delta-delta Ct method, with HPRT as the housekeeping gene. Primers used are shown in Table 1 .
Primers for qRT-PCR
| IL-10 | ′5-CAGGGATCTTAGCTAACGGAAA-3′ |
| ′5-GCTCAGTGAATAAATAGAATGGGAAC-3′ | |
| IL-22 | ′5-ATGAGTTTTTCCCTTATGGGGAC-3′ |
| ′5-GCTGGAAGTTGGACACCTCAA-3′ | |
| HPRT | ′5-CCTAAGATGAGCGCAAGTTGAA-3′ |
| ′5-CCACAGGACTAGAACACCTGCTAA-3′ | |
| Lysoyzme P | ′5-ATGGCTACCGTGGTGTCA-3′ |
| ′5-CGGTCTCCACGGTTGTAGTT-3′ | |
| Cryptdin | ′5-AAGAGACTAAAACTGAGGAGCAGC-3′ |
| ′5-GGTGATCATGAGACCCCAGCATCAGT-3′ |
7
Gene Expression and Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated and purified using TRIzol reagent (Invitrogen, #15596026) according to the manufacturer's protocol. cDNA was prepared to employ a CycleScript RT premix (Bioneer, #K-2044-CFG). All primer sequences are listed in Table 1 . Expression levels were calculated using a SensiFAST SYBR Lo-ROX Kit (Bioline, #BIO-94020) and a commercial detection system (BioRad, #CFX96).
Total proteins were extracted into RIPA buffer (Thermo Fisher Scientific, #89900) containing a phosphatase inhibitor (Sigma-Aldrich, #4906845001) and a protease inhibitor (Roche, #43693159001), subjected to 10–16% (w/v) Tris-glycine SDS-PAGE, transferred to PVDF membranes using Iblot 2 NC ministacks (Invitrogen, #IB23002), and the membranes blocked with 5% (w/v) skim milk. The primary antibodies were anti-pAMPK (Cell Signaling Technology, #2531S), anti-AMPK (Cell Signaling Technology, #5831S), anti-pACC (Cell Signaling Technology, #3661S), anti-ACC (Cell Signaling Technology, #3662S), and anti-GAPDH (Cell Signaling Technology, #2118S) diluted 1:1000 (primary antibodies) or 1:5000 (secondary antibodies) in TBST (Biosesang, #HT2007) containing 5% (w/v) skim milk. The membranes were then incubated with a peroxidase-conjugated anti-rabbit secondary antibody and signals quantitated using the Immobilion Western Chemiluminescent HRP Substrate (Millipore, #WBKLS0500).
Total proteins were extracted into RIPA buffer (Thermo Fisher Scientific, #89900) containing a phosphatase inhibitor (Sigma-Aldrich, #4906845001) and a protease inhibitor (Roche, #43693159001), subjected to 10–16% (w/v) Tris-glycine SDS-PAGE, transferred to PVDF membranes using Iblot 2 NC ministacks (Invitrogen, #IB23002), and the membranes blocked with 5% (w/v) skim milk. The primary antibodies were anti-pAMPK (Cell Signaling Technology, #2531S), anti-AMPK (Cell Signaling Technology, #5831S), anti-pACC (Cell Signaling Technology, #3661S), anti-ACC (Cell Signaling Technology, #3662S), and anti-GAPDH (Cell Signaling Technology, #2118S) diluted 1:1000 (primary antibodies) or 1:5000 (secondary antibodies) in TBST (Biosesang, #HT2007) containing 5% (w/v) skim milk. The membranes were then incubated with a peroxidase-conjugated anti-rabbit secondary antibody and signals quantitated using the Immobilion Western Chemiluminescent HRP Substrate (Millipore, #WBKLS0500).
8
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (#15596–026, Ambion) followed by isopropanol precipitation was used for total RNA extraction. The cDNA was generated according to the manufacturer’s instructions with High-Capacity cDNA Reverse Transcription Kit (#4368814, Applied Biosystems). Primers for RT-qPCR were designed using NCBI Primer BLAST (S2 Table ), and RT-qPCR performed with SensiFAST SYBR Lo-ROX Kit (#BIO-94020, Bioline) using a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). The RT-qPCR reactions were performed using 1 ng/μL cDNA per reaction in technical triplicates and the fold change in gene expression was calculated with the 2(-Delta Delta C(T)) method [62 (link)], normalized to the geometrical mean of Actin and human ribosomal protein lateral stalk subunit P0 (RPLP0) expression. Standard curves for primer efficiency were calculated using the formula E = 10^(-1/slope) for each primer pair.
9
Quantifying Adipocyte Fabp4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RT-PCR analysis, cells were seeded on 12-well plates for 24 h. Cells were transfected with (dCas9/sgFabp4) + ATS-9R oligoplexes and incubated for an additional 24 h. Total RNA were isolated from pre-adipocytes and mature adipocytes using the RNeasy Lipid Tissue Mini kit (Qiagen GmbH) according to the manufacturer's protocol, and cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad). The Fabp4 mRNAs were measured by quantitative real-time PCR (qRT-PCR) using a SensiFAST SYBR Lo-ROX kit (Bioline). Mouse Gapdh was used as an endogenous control. The ΔΔCt method was used to calculate the Fabp4 mRNA level relative to that of Gapdh.
10
Rat Gut Microbiome Profiling by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial genomic DNA samples were extracted from rat fecal pellets using a commercial genomic DNA isolation kit (QIAGEN, Germany). Briefly, the fecal pellet (0.25 g) was homogenized in QIAGEN ASL lysis buffer using a Mini-Beadbeater (BioSpec Products, Bartlesville, OK). The manufacturer’s instructions were then followed to extract the bacterial genomic DNA from the rat fecal pellets. Extracted bacterial genomic DNA was diluted 1:10 and 0.04 mL was used as the template for the SYBR-Green-based (SensiFAST SYBR Lo-ROX kit, Bioline, Taunton, MA) real-time polymerase chain reaction using primers previously described [11 (link),36 (link),61 (link)]. The bacterial microbiota population fractions (Firmicutes/Bacteroidetes ratio and Enterobacteriaceae) were calculated using quantitative polymerase chain reaction data (qPCR) as described previously [11 (link),36 (link)]. The percentage of each bacterial phylum was determined by dividing by Eubacteria level as previously described [11 (link),36 (link),61 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!