FTIR (Bruker Optick Gm BH, Ettlingen, Germany), Leica stereomicroscope (Model: S9D), RNAiso Plus reagent (#9108, TAKARA, Shiga, Japan), MicroDrop spectrophotometer (Multiscan Sky, Thermo Scientific, Waltham, MA, USA), qPCR (QuantStudioTM 5 Real-Time PCR system, Applied Biosystems, Waltham, MA, USA), Olympus BX53 fluorescent microscope, T.B. Green master mix (RR820A, TAKARA, Japan), DCFH-DA; Sigma, St. Louis, MO, USA, 2201608), anti-caspase 3 (1:500, #9661S, R&D systems, Minneapolis, MN, USA) and secondary antibody (#A11030; Goat anti-mouse Alexa flourTM 546; 1:500 dilution).
Tb green master mix
Manufactured by Takara Bio
Sourced in Japan, China, United States
TB Green Master Mix is a ready-to-use solution for real-time PCR amplification and detection. It contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and TB Green dye for DNA quantification.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt master mix, by Takara Bio (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Quantstudiotm 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rnaiso plus reagent, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Leica stereomicroscope, by Leica camera (1 mentions)
Dcfh da, by Merck Group (1 mentions)
Cfx connect real time pcr system, by Bio-Rad (1 mentions)
Trizol total rna isolation reagent, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Quantstudio 12 k flex real time pcr system, by Takara Bio (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Step one system, by Bio-Rad (1 mentions)
High capacity cdna reverse transcription kit, by Takara Bio (1 mentions)
Dnase 1, by Merck Group (1 mentions)
Quantstudio 3, by Thermo Fisher Scientific (1 mentions)
19 protocols using tb green master mix
1
Comprehensive Multimodal Analysis of Cellular Functions
2
Quantifying SPAG6 and Autophagy Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted separately from cells treated with NC-shRNA or SPAG6-shRNA using TRIzol reagent (Takara Biotechnology Co., Ltd.); then, the RNA samples were reverse transcribed into cDNA using a PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd.), according to the manufacturer's protocols. qPCR was subsequently performed using a CFX-Connect Real-Time PCR system (Bio-Rad Laboratories, Inc.) and TB Green Master Mix (Takara Biotechnology Co., Ltd.) for a total of 45 cycles, following standard assay procedures. The thermocycling parameters used were 95°C for 30 sec, followed by 45 cycles at 95°C for 5 sec and 62°C for 30 sec. The mRNA expression levels of SPAG6 and autophagy-associated genes were calculated using the 2−ΔΔCq method (21 (link)) with GAPDH as an internal control. The primer sequences are listed in Table I .
3
Quantitative Analysis of SPAG6 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total bone marrow nucleated cellular RNA was isolated from each sample using TRIzol® (Total RNA Isolation) reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using a reverse transcription kit (PrimeScript™ RT reagent Kit; Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. qPCR was subsequently performed using a CFX96 Real Time PCR Detection system (Bio-Rad Laboratories, Inc.). The PCR system and cycle parameters used were as previously described (22 (link)). The total reaction volume was 10 µl and this was prepared as follows: 5 µl TB Green Master Mix (Takara Biotechnology Co., Ltd.), 0.5 µl of each primer, 1 µl cDNA template and 3.0 µl ddH2O. The thermocycling conditions used for qPCR were as follows: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec. The relative mRNA expression levels of SPAG6 were calculated using the 2−ΔΔCq method (23 (link)), and GAPDH acted as the internal control. The following primers sequences were used for qPCR: SPAG6 forward, 5′-AGTGCGACATTCTTCCACAGCTTG-3′ and reverse, 5′-GCGTATCCAGTGCTCCACAATCG-3′; and GAPDH forward, 5′-CTTTGGTATCGTGGAAGGACTC-3′ and reverse, 5′-GTAGAGGCAGGGATGATGTTCT-3′.
4
Quantitative Expression Analysis of Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from L4/5 DRGs or whole retinae after LBP, glycopyrrolate or mexiletine treatment using Trizol reagent (Invitrogen)39 (link),82 (link). After the determination of RNA concentration, total RNA was reverse transcribed using PrimeScript RT Master Mix (Takara). Triplicate qPCR reactions were performed using TB Green Master Mix (Takara) on a QuantStudio 12 K Flex Real-Time PCR system. The Ct-values were recorded and the relative fold-change of each gene was calculated using 2−ΔΔCt method39 (link),82 (link). Gapdh was used for normalization. All the primers used in this study was listed in Supplementary Table 2 .
5
Quantitative RT-PCR Analysis of Antioxidant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 24 h of transgene expression as above, cells were collected by trypsinization and subsequent centrifugation at 1200× g. RNA was isolated using an RNeasy kit (Qiagen, Hilden, Germany) and RNA concentrations measured using a NanoDrop instrument. 1 ng of RNA was then subjected to reverse transcription reaction with oligo dT primers using a SuperScript III First-Strand Synthesis kit from Invitrogen. Quantitative RT-PCR reactions were measured on a Viia 7 Real-Time PCR system (Thermo) using a TB Green master mix from Takara. Primers used were HMOX1 (forward: GAGTGTAAGGACCCATCGGA, reverse: GCCAGCAACAAAGTGCAAG) and NQO1 (forward: GCCTCCTTCATGGCATAGTT, reverse: GGACTGCACCAGAGCCAT). Reactions were normalized to TUBG1 levels (forward: ATCTGCCTCCCGGTCTATG, reverse: TACCTGTCGGAACATGGAGG) and relative transcript abundance calculated using the comparative Ct method.
6
Analyzing Gene Expression in Brain Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain tissues or cells were sonicated and lysed with TRIzol (Invitrogen, 10296010). Total RNA was extracted according to the manufacturer's instructions and treated with DNase I (Sigma-Aldrich, AMPD1). Next, cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Takara, RR037Q). The qRT-PCR analysis was performed on a Step-one System (Bio-Rad) with TB Green Mastermix (Takara, R075A). Relative mRNA expression was determined through the 2–ΔΔCt method and normalized to GAPDH expression. The primer sequences are shown in Supplementary Table 1 .
7
Whole Blood RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole blood using an RNA extraction kit (iNtRON Biotechnology, Gyeonggi-do, Korea). RNA (50 ng) was reverse transcribed to cDNA using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA). Real-time PCR was performed with TB Green Master Mix (TaKaRa Bio, Otsu, Japan) and was analyzed using QuantStudio 3 (Thermo Fisher Scientific, San Jose, CA, USA). The primer sequences used for PCR are shown in Supplementary Table 1 and were normalized to β-actin.
8
Quantitative Analysis of BLVgR mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of BLVgR mRNA in different tissues, developmental stages and reproductive status of workers and queens, as well as the results of different RNAi treatments, were analyzed by real-time quantitative PCR using a Stratagene Mx3000 real-time PCR system (Agilent, USA). First-strand cDNA samples, were diluted (1:10 v/v) with DEPC-treated water. Amplification was carried out in a 20 µL reaction volume containing 10 µL of 10 × TB Green Master Mix (Takara, Dalian, China), 2 µL cDNA, and 0.5 µL of each 10 µm primer (Table 1 ). Quantitative measurements were normalized using β-actin and GAPDH. The qPCR conditions were as follows 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 63 °C for 1 min. Each assay was performed in triplicate and repeated with three independent samples. The relative quantities of BLVgR transcripts were calculated using the comparative Ct method [39 (link)].
9
Quantifying Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol (Invitrogen), and approximately 1 μg of total RNA was used for cDNA synthesis using the PrimeScript TM RT reagent kit (Takara, RR047A) according to the manufacturer’s instructions. For the PCR reaction, the 200 ng cDNA and 10 μM primers were mixed with 5 µl TB Green master mix (Takara, RR820A) and added the ddH2O to 10 µl reaction system for one sample. The following primers were used: actin: F: 5-GACCTGACTGACTACCTCATGAAGAT-3 and R: 5-GTCACACTTCATGATGGAGTTGAAGG-3; HIC1: F: 5-CGACAAGAGCTACAAGGACC-3 and R: 5- CAGATGGTGCATGGGTAGG -3. The primers for mature miR-144-3p and U6 were purchased from Takara. Actin was used as the reference gene for HIC1 analysis and U6 was used as the reference gene for miR-144-3p analysis. The ΔΔCt method was used for the relative gene expression calculation.
10
Analyzing Differential Gene Expression in Mated Queen Spermathecae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fifteen DEGs were selected as candidates to analyze their expression differences in the spermathecae of queens that response to mating by RT-qPCR using a Stratagene Mx3000 real-time PCR system (Agilent, United States). The primers were designed with Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi ), and the primer sequences are shown in Supplementary Table S1 . First-strand cDNA samples were diluted (1:10 v/v) with DEPC-treated water. Amplification was carried out in a 20 µL reaction volume containing 10 µL of 10 × TB Green Master Mix (Takara, Dalian, China), 2 µL cDNA, and 0.5 µL of each primer at 10 µm. Quantitative measurements were normalized using β-actin and RP49. The qPCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, and 63°C for 1 min. RT-qPCR was performed in duplicate on each of three independent biological replicates. All results are presented as the mean ± SEM of the biological replicates. The relative quantities of transcripts were calculated using the comparative Ct method (Livak and Schmittgen, 2001 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!