Total RNA was isolated from 100 mg of thymus, homogenized with 2 mL of TRIzol™ LS Reagent using a homogenizer150 (FisherBrand™ Thermo Fisher Scientific, Barcelona, Spain) and the NucleoSpin® RNA virus columns kit (Macherey-Nagel, Düren, Germany) according to manufacturer’s protocols. To remove genomic DNA, a DNase type I Ambion® TURBO-DNA-free™ kit (Life Technologies, Carlsbad, CA, USA) was applied. Concentration and purity of the extracted RNA were determined by spectrophotometry using the Nanodrop 2000 (Thermo Fisher Scientific, Barcelona, Spain), considering samples with a ratio 260/280 of about 2. The script™ cDNA Synthesis Kit (BioRad, Hércules, CA, USA) was used to generate cDNAs from 1 μl of total RNA as proposed by the manufacturer.
Script cdna synthesis kit
Manufactured by Bio-Rad
Sourced in United States
The Script cDNA Synthesis Kit is a reagent kit designed to facilitate the reverse transcription of RNA into complementary DNA (cDNA) for subsequent use in various molecular biology applications, such as gene expression analysis, cloning, and sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (6 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Power sybr green, by Thermo Fisher Scientific (5 mentions)
Sybr premix ex taq 2, by Takara Bio (3 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Homogenizer 150, by Thermo Fisher Scientific (2 mentions)
Nucleospin rna virus columns kit, by Macherey-Nagel (2 mentions)
Cfx96 real time quantitative pcr, by Bio-Rad (2 mentions)
Ssoadvanced sybr green supermix, by Bio-Rad (2 mentions)
Dnase type 1 ambion turbo dna free kit, by Thermo Fisher Scientific (2 mentions)
Mirneasy micro kit, by Qiagen (2 mentions)
Trizol reagent, by Corning (2 mentions)
Sybr green supermix, by Bio-Rad (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Trizol ls, by Thermo Fisher Scientific (2 mentions)
Abi prism 7900 pcr machine, by Thermo Fisher Scientific (2 mentions)
40 protocols using script cdna synthesis kit
1
Thymus Total RNA Isolation and cDNA Synthesis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Modulation of gene expression was conducted by qRT-PCR analysis using an approach similar to that described in the literature [17 (link)]. Briefly, the total RNA obtained from each treatment was isolated using the TRIzol® reagent and quantified using a NanoDrop™ 1000 Spectrophotometer System® (Thermo Fisher Scientific, Wilmington, DE, USA). Then, a cDNA was obtained using the Script™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions. qRT-PCR was performed on a Rotor-Gene Q 5plex HRM system (QIAGEN biotechnology, Hilden, Germany). A melting curve was generated from 60 °C to 90 °C in 0.5 °C increments for 5 s at each temperature. All reactions were performed in triplicate, with 1 µM of each primer and 2× QuantiFast SYBR® Green PCR Master Mix; the final reaction volume was 20 µL. Specific forward and reverse primer sequences are listed in Table 1 .
The β-actin housekeeping gene was used as an internal control of gene expression analysis. Relative gene expression was calculated using the comparative Ct method and expressed as fold expression relative to the control.
The β-actin housekeeping gene was used as an internal control of gene expression analysis. Relative gene expression was calculated using the comparative Ct method and expressed as fold expression relative to the control.
3
Quantifying Sirtuin Gene Expression Using qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy Mini Kit (Qiagen, MD, USA) was used to isolate total RNA, and the cDNA was synthesized using script cDNA synthesis kit (Bio-Rad, CA, USA) following the manufacturer’s instructions. Quantitative PCR was performed using SYBR Premix Ex Taq II (TaKaRa, Japan) on CFX96 real-time PCR detection system (Bio-Rad, CA, USA) with the primers in Table 1 . Values for each gene were normalized to the expression of GAPDH.
Primers of QRT-PCR.
| Gene | Forward | Reverse |
|---|---|---|
| KIAA1429 | AAGTGCCCCTGTTTTCGATAG | ACCAGACCATCAGTATTCACCT |
| SIRT1 | TAGACACGCTGGAACAGGTTGC | CTCCTCGTACAGCTTCACAGTC |
| SIRT2 | CTGCGGAACTTATTCTCCCAGAC | CCACCAAACAGATGACTCTGCG |
| SIRT3 | CCCTGGAAACTACAAGCCCAAC | GCAGAGGCAAAGGTTCCATGAG |
| SIRT4 | GTGGATGCTTTGCACACCAAGG | GGTTCAGGACTTGGAAACGCTC |
| SIRT5 | GTCCACACGAAACCAGATTTGCC | TCCTCTGAAGGTCGGAACACCA |
| SIRT6 | TGGCAGTCTTCCAGTGTGGTGT | CGCTCTCAAAGGTGGTGTCGAA |
| SIRT7 | TGGAGTGTGGACACTGCTTCAG | CCGTCACAGTTCTGAGACACCA |
| GAPDH | AATCCCATCACCATCTTCCAG | AAATGAGCCCCAGCCTTC |
4
Sepsis-related miR-451a Expression in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The peripheral blood monocyte cells (PBMCs) were isolated and proposed for miR-451a measurement using reverse transcription quantitative polymerase chain reaction (RT-qPCR) in 117 patients with sepsis and 50 HCs. Briefly, the total RNA extraction was accomplished using a PureZOL RNA isolation reagent (Bio-Rad, Hercules, California, United States), and then reverse transcription was performed by the Script™ cDNA Synthesis Kit (Bio-Rad, Hercules, California, United States). Consequently, qPCR reaction was performed by the TB Green™ Fast qPCR Mix (Takara, Kusatsu, Shiga, Japan). The relative expression of miR-451a was calculated based on the 2–ΔΔCt method using U6 as an internal reference. The detailed primers were designed in line with a previous study (Wang et al., 2020 (link)).
5
mRNA Stability Analysis in PANC-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA stability analysis was performed as previously described (33 (link)). Briefly, PANC-1 cells infected with scramble or METTL14 shRNA for 72 h were directly harvested or treated with 5 mM Actinomycin D and harvested at the indicated time points. Equal RNA amounts (1 μg) were transcribed into cDNA using the script cDNA synthesis kit (Bio-Rad, USA). Gene expression was analyzed using the SYBRGreen reagent (TAKARA, Japan).
6
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were homogenized in RNeasy mRNA kit (Qiagen) and stored at −80 °C before total RNA extractions according to the manufacturer’s protocol. cDNA synthesis was performed using Script™cDNA Synthesis Kit (Bio-Rad). cDNA was analyzed using real-time PCR SsoAdvanced™ SYBR® Green Supermix from Bio-Rad using appropriate primers and run on a Bio-Rad CFX96 real-time quantitative PCR (qPCR) system. Gene expression was normalized to the housekeeping gene GAPDH and calculated using the 2−ΔCt method. Melt curve analyses were performed to ensure the specificity of qPCR product. Primer sequences can be provided on request. Values are mean ± SEM of three independent experiments, and within each experiment, triplicate samples were assessed.
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was removed from mRNA samples by use of a commercial kit (RNeasy plus Mini Kit, Qiagen, USA) following the manufacturer instructions immediately after mRNA isolation from cultured macrophages. First-strand cDNA was synthesized by use of a commercial kit (Script cDNA Synthesis Kit, Bio-Rad, USA) following the manufacturer instructions. Then, cDNA was diluted to 100 μl total volume and SYBR green master mix was added (Power SYBR Master Mix, Life Technologies, USA). Samples were analyzed in triplicate in a 96-well optical reaction plate. Each sample contained 5 μl of cDNA diluted to 1:10 in DNAse free water and 15 μl of SYBR green master mix. Primers (Table 1 ) were designed using a web-based program; http://biotools.umassmed.edu/bioapps/primer3_www.cgi ). Gene expression was evaluated as relative fold expression using the ∆∆Ct method. GAPDH was used as an endogenous control to normalize the gene expression input. Preliminary results showed no variation in the expression of GAPDH in macrophages treated with the chemical MAPKp38 inhibitor (SB203580, Sigma-Aldrich, USA), or DMSO to untreated macrophages (data not shown).
8
Lung, Lymph Node, and Thymus RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 100 mg of lung, tracheobronchial lymph node, and thymus homogenized with 2 ml of TRIzol™ LS Reagent using homogenizer 150 (FisherBrand™, Thermo Fisher Scientific) and the NucleoSpin® RNA Virus Column kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocols. In order to remove genomic DNA, a DNase type I Ambion® TURBO-DNA-free™ kit (Life Technologies, Carlsbad, CA, USA) was applied following the manufacturer’s instructions. The concentration and purity of the extracted RNA were determined by spectrophotometry using the Nanodrop 2000 (Thermo Fisher Scientific). One microliter of total RNA was used to generate cDNA using the Script™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA) following the manufacturer’s indications.
9
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from gastric tissues using an RNeasy Plus Mini-kit (Qiagen, Valencia, CA, USA). First-strand cDNA was synthesized using a Script cDNA synthesis kit (Bio-Rad, CA) and amplified in 3 technical replicates using Power SYBR Green (Life Technologies, CA, USA) and an Applied Biosystems 7500 instrument. The PCR conditions were 95°C for 4 min, followed by 40 cycles of 94°C for 60 s and 55°C for 60 s, and final extension at 72°C for 10 min. After amplification, cycle number at the linear amplification threshold (Ct) values for the reference gene Gapdh, each sample, and relative gene expression were determined using the comparative Ct method [30 (link)]. All PCR primers used for Hmox1, Bcl2, Bax, Casp3 and Gapdh were designed using the Primer-Blast program of NCBI and synthesized by Jena Bioscience GmbH (Jena, Germany). Primer sequences and accession numbers of the examined genes have been previously published [31 ] and are provided as a Supporting information (S1 Table ).
10
Quantitative Analysis of circRBM33 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell and tissue samples using TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. After spectrophotometric quantification, 1 µg of total RNA in a final volume of 20 µL was used for reverse transcription (RT) with a Script cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) following the manufacturer’s instructions. According to the manufacturer’s protocol, total cDNA was then used for qRT-PCR with the TaqMan Gene Expression Assay (Thermo Fisher Scientific, Rockford, IL, USA) in a StepOne Plus Real-time PCR System (Thermo Fisher Scientific). The expression of human GAPDH genes was used as a control to calibrate the original concentration of tissue or cell mRNA, respectively. Target gene expression was calculated using the 2-ΔΔCT method. Each quantitative PCR assay was performed in triplicate and independently repeated three times. The primer information for the exhibition is as follows: circRBM33, forward: 5'-ATGTGGAAGAGCCAGAGGAG-3', reverse: 5'-GCCAGATAGCAAATCTTCTCCA-3'; GAPDH: forward: 5′-AGATCCCTCCAAAATCAAGTGG -3′, reverse: 5′-GGCAGAGATGATGACCCTTTT-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!