Red blood cell lysis buffer

Peripheral blood of each mice was collected after 24 hours of CLP or Sham operation, and was treated with Red Blood Cell Lysis Buffer (Biosharp, Anhui, China). Total RNA was extracted from blood cells by RNA Fast 200 kit (Fastagen, Shanghai, China). Then reverse transcription was performed with the PrimeScript RT reagent Kit with gDNAEraser (Takara, Tokyo, Japan). Quantitative real-time PCR was conducted with the SYBR Green PCR kit (Yeasen, Shanghai, China) and StepOnePlus Real-Time PCR System (Thermo Scientific, Massachusetts, United States). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer sequences of ARG1 and GAPDH were as following: ARG1: forward TCACCTGAGCTTTGATGTCGA; reverse TGAAAGGAGCCCTGTCTTGTA. GAPDH: forward TCACCATCTTCCAGGAGCGAGAC; reverse AGACACCAGTA GACTCCACGACATAC. The results were analyzed by Mann-Whitney U test.

After treatment, mouse blood was collected in a test tube coated with the anticoagulant. Red blood cells were removed by incubating blood samples in a red blood cell lysis buffer (Biosharp) for 15 min on ice, followed by the addition of cold PBS and centrifugation for 10 min at ∼400 g at 4^oC. About 10⁵ re-suspended cells in 100 μL were added with the corresponding antibody (CD3/CD4/CD8 or CD45/CD11b/Ly6C) and incubated for 30 min at RT with protection against light. After washing with PBS, the cells were re-suspended in PBS and subjected to FACS analysis.

Cell isolation was performed according to a previous procedure^{60 (link)–62 (link)} with some adaptations. Briefly, after 4 mice were sacrificed, subcutaneous tumors were collected and cut into small pieces (<2 mm in diameter) and then digested with 10 ml of dissociation solution (RPMI 1640 medium containing 10% FBS, 1 mg/mL collagenase type IV (Biosharp, Hefei, China), 100 µg/mL DNase I (Biosharp, Hefei, China), and 2.5 µg/mL hyaluronidase (Biosharp, Hefei, China)) for 60 min on a 37 °C shaker. Next, 4 ml RPMI 1640 medium containing 10% FBS was added to dilute the suspensions. Then, the cell suspensions were passed through 70 µm cell strainers, and the lower layer was collected after centrifuging at 400 × g for 10 min. Subsequently, the erythrocytes were lysed with red blood cell lysis buffer (Biosharp, Hefei, China) according to the manufacturer’s instructions and then washed and resuspended the remaining single cells in PBS.

Human primary granulosa cells (PGCs) were isolated from the follicular fluids in 30 patients who received in vitro fertilization and embryo transfer (IVF‐ET) treatment in the Third Affiliated Hospital of Guangzhou Medical University as described previously.¹⁵, ¹⁶ First, the follicular fluids were collected and centrifuged at 526 g for 15 min (Sorvall ST40R; Thermo Fisher Scientific). The supernatant was discarded, and the pellet was added into the lymphocyte separation buffer (Biosharp Life Sciences, Hefei, Anhui, China) at a volume ratio of 1:2, followed by centrifugation at 234 g for 10 min. After that, the pellet was divided into four layers—follicle fluid layer, granulosa cell layer, lymphocyte separation medium layer and red blood cells layer. The granulosa cell layer was extracted and centrifuged at 234 g for 5 min with red blood cell lysis buffer (Biosharp Life Sciences) at a volume ratio of 1:3. The supernatant was discarded, and the pellet was washed thrice with PBS. The isolated granulosa cells were subjected to subsequent treatments. In all the experiments, only the first passage of PGCs was used.
All of the procedures in the present study were reviewed and supported by the Ethic Committee of Guangzhou Medical University. We received agreement, permission and signed consent from all patients included in the present study.

Decidual and placental tissues were minced into approximately 0.2–1-mm³ cubes with scissors and digested with 10 mL of 10 mg/mL collagenase IV (Sigma, USA) solution in RPMI 1640 medium (Gibco, USA) with 10% FBS (Gibco, USA) at 37°C for 90 min in a shaking incubator. The supernatant was diluted with medium and filtered through 100-μm, 70-μm, and 40-μm cell strainers (Miltenyi, Germany) in sequence. The flow-through was centrifuged and resuspended in 5 mL of red blood cell lysis buffer (Biosharp, China) for 8 min. The mixture was centrifuged at 300 × g and 4°C for 5 min, and the cell pellet was resuspended in 1 mL of medium for 10× single-cell sequencing.

After the mice were sacrificed, the spleens and tumors were dissected. The tissues were ground into a cell suspension in PBS and filtered with a 70 µm cell sieve. The erythrocytes were removed by the Red Blood Cell Lysis Buffer (Biosharp, Anhui, China). The tissue cells were washed three times with PBS and counted by cell counting apparatus. 1 × 10⁶ cells from each sample were stained with PE anti‐Mouse CD4 (BioLegend, San Diego, CA, USA) and APC anti‐Mouse CD8 (BioLegend, San Diego, CA, USA). After staining, analyses were performed by flow cytometry.

A Total of 77 bone marrow samples from AML patients and 72 control samples from healthy volunteers were collected from October 2019 to December 2021. A total of 5 AML patients presenting with high leukocyte counts consented to undergo leukapheresis to collect primary cells. Peripheral blood mononuclear cells (PBMC) from 2 healthy donors were extracted to detect the toxicity of drugs. The mononuclear cells were separated using a lymphocytes separation medium (MP biomedicals, Cat. No.S5019, USA) and erythrocytes were lysed with red blood cell lysis buffer (Biosharp, Cat. No. BL503A, China). Total RNA was isolated from samples using Trizol as described previously [12 (link)], and the complementary DNA was prepared for the detection of the target genes by Real-time quantitative Polymerase Chain Reaction (RT-qPCR). The primary cells were cultured in Roswell Park Memorial Institute 1640 medium (RPMI 1640, Gibco, USA) with 10% fetal bovine serum (FBS, Gibco, USA) and subsequently used in various experiments. The characterization of the patients is shown in Additional file 1: Table S1. The cases of AML at Zhongda Hospital Southeast University were used in this study after the acquisition of written informed consent, and by the tenets of the Declaration of Helsinki and approved by the Independent Ethics Committee for Clinical Research of Zhongda Hospital Southeast University.