Fast sybr green master kit

Caco-2 cells were seeded into 10-cm petri dishes (2 × 10⁶ cell/well). After attachment, cells were pretreated with 10 mM NAC for 1 h to increase the GSH level before treatment with RM4819 (20 μM) or DMSO (0.1%) for further 8 h. Cells were harvested, lysed in PeqGOLD TriFast (PeqLab, Erlangen, Germany) RNA isolation reagent and RNA was isolated according to the manufacturer's protocol. One microgram of RNA was reverse transcribed and cDNAs were used for quantification of gene expression by quantitative PCR using FASTSYBR Green Master Kit and a StepOnePlus Real time PCR system (Applied Biosystems, Foster City, CA, USA). The following primers were used: human Bim forward 5′-ATG AGA AGA TCC TCC CTG CT-3′ and reverse 5′-AAT GCA TTC TCC ACA CCA GG-3′, GAPDH forward 5′-ATG GAG AAG GCT GGG GCT CA-3′ and reverse 5′-AGT GAT GGC ATG GAC TGT GGT CAT-3′ to normalize the gene expression by GAPDH expression levels.

For RNA isolation cells were lysed in 1 ml peqGOLD TriFast reagent (PeqLab, Erlangen, Germany). Tissue samples were homogenized in 1 ml TriFast using the TissueLyser II (Quiagen, Hilden, Germany). RNA was isolated according to the manufacturers protocol. One microgram of RNA was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and cDNAs were used for quantification of gene expression by quantitative PCR using FAST SYBR Green Master Kit and a StepOnePlus Real-time PCR system (Applied Biosystems) with primers stated in Table 1.

Total RNA was obtained, and reverse transcription was performed as previously described.³⁰ cDNA synthesis was performed with RevertAid First Strand cDNA synthesis Kit (Thermo Scientific) following manufacturer's protocol in an iCycler thermal cycler (Biorad). Real‐time PCR was performed with Fast SYBR Green Master kit (Thermo Scientific) in a 7500 Fast Real‐Time PCR instrument (Applied Biosystems). The PCR conditions were performed as previously described.³⁰ Primers were designed by using the NCBI BLAST software and purchased from Sigma‐Aldrich. Primers sequences used are as follows: ERK5 forward 5′‐AGCACTTTAAACACGACAAC‐3′; ERK5 reverse 5′‐ TAGACAGATTTGAATTCGCC‐3; GAPDH forward 5′‐TCGTGGAAGGACTCATGACCA‐3′; GAPDH reverse 5′‐CAGTCTTCTGGGTGGCAGTGA‐3′.