Pooled siRNA against PSN1 and PSN2 and single siRNA sequence against ADAM10 (sc-41410C) were purchased from Santa Cruz Biotechnology. One control siRNA (also referred to as control 1 siRNA) was purchased from Thermo Scientific (On Target Pulse Non-targeting siRNA #1). The sequence for control 2 siRNA is 5′ CAACAAGAUGAAGAGCACCAAUU 3′ (synthesized by Thermo Scientific) [7 (link)]. Primary human fibroblasts were doubly transfected (at 0 and 48 hours) overnight with siRNA using the lipid reagent Dharmafect 3 (Thermo Scientific). Cells were rested for 24 hours and then serum-starved overnight in Opti-MEM before ionomycin stimulation. NCI-H460 cells were singly transfected with siRNA using the lipid reagent Dharmafect 1 (Thermo Scientific) for 24 hours and then serum-starved overnight in Opti-MEM before stimulation.
Dharmafect 3
Manufactured by Thermo Fisher Scientific
Sourced in United States
DharmaFECT 3 is a transfection reagent used for delivering nucleic acids into cells. It is designed to efficiently transfect a variety of cell types, including difficult-to-transfect cells. The reagent forms complexes with nucleic acids, which are then taken up by the cells.
Automatically generated - may contain errors
Lab products found in correlation
Dharmafect 1, by Thermo Fisher Scientific (2 mentions)
Thapsigargin, by Merck Group (1 mentions)
4 hydroxytamoxifen, by Merck Group (1 mentions)
Ribose, by Merck Group (1 mentions)
Ifn γ, by R&D Systems (1 mentions)
Tnf α, by R&D Systems (1 mentions)
Eight well chamber slide, by Thermo Fisher Scientific (1 mentions)
Dharmafect 4, by Thermo Fisher Scientific (1 mentions)
5 protocols using dharmafect 3
1
Knockdown of PSN1, PSN2, and ADAM10 in Fibroblasts and NCI-H460 Cells
2
Cytokine-Induced Cellular Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cytokines IL1β, IFNγ and TNFα were obtained from R&D Systems (Minneapolis, MN, USA). Ribose, thapsigargin and 4-hydroxytamoxifen were from Sigma (St. Louis, MI, USA). Control Non-Targeting and ON-TARGETplus SMARTpool siRNAs and transfection reagent DharmaFECT3 were from Thermo Fisher Scientific (Lafayette, CO, USA).
3
Targeted siRNA Knockdown in MCF10A Cells
4
Investigating miR-342-3p Function in RAW264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the potential function of miR-342-3p, RAW264.7 cells were transfected with 30 nM miR-342-3p precursor (Applied Biosystems) or scrambled miRNA negative control (Applied Biosystems) using DharmaFECT 3 (Thermo Scientific) in 12- and 96-well plates (Sigma-Aldrich) and eight-well chamber slides (Thermo Scientific).
5
siRNA Transfection for Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of siRNAs are present in the Supplementary Table 4 . The cells were transfected with DharmaFECT 1 (SUM159, MCF7, MCF10A), DharmaFECT 3 (HS27) or DharmaFECT 4 (HB2) (Thermo-Scientific) following the manufacturer's instructions. All experiments were done 48 h after transfection and all the siRNAs were used at a final concentration of 50 nM.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!