Log In Sign up
The largest database of trusted experimental protocols

Im 300 microinjector

Manufactured by Narishige
Visit Supplier
Sourced in Japan, United States

The IM 300 Microinjector is a laboratory instrument designed for precise microinjection. It provides accurate control over the injection volume and pressure for a variety of applications in cell biology and biotechnology.

Automatically generated - may contain errors

Lab products found in correlation

Mmessage mmachine kit, by Thermo Fisher Scientific (6 mentions) Szx9 stereomicroscope, by Olympus (3 mentions) Szx16 stereomicroscope, by Olympus (3 mentions) Smz745, by Nikon (2 mentions) Pc 10 puller, by Narishige (2 mentions) Nrf2a mo, by Gene Tools (2 mentions) Trypsin, by Thermo Fisher Scientific (2 mentions) Cm dii, by Thermo Fisher Scientific (2 mentions) M165 fc, by Leica (2 mentions) Dfc450c, by Leica (2 mentions) Ix70 fla inverted fluorescence microscope, by Olympus (2 mentions) Morpholino, by Gene Tools (2 mentions) Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Sodium chloride (nacl), by Fujifilm (1 mentions) Pulled thin wall glass capillaries, by Harvard Apparatus (1 mentions) Mmessage mmachine, by Thermo Fisher Scientific (1 mentions) Ahr2 mo, by Gene Tools (1 mentions) Ctrl mo, by Gene Tools (1 mentions) Isogen, by Fujifilm (1 mentions)

Close spelling variants of this product

IM-300 (29 citations) Microinjector (38 citations)

69 protocols using im 300 microinjector

1

Transplantation of Fluorescent Tumor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fluorescent-labeled clones were generated in larval eye discs using the ey-FLP MARCM (eyMARCM) system9 (link). Following dissection and collection of GFP (Green Fluorescent Protein)-labeled RasV12/scrib−/− malignant tumor tissue from third-instar larvae, the tumors were treated with 0.083% trypsin (Wako, Japan, Catalog No. TWF7014) for 5 min, passed through a 27-G needle (TERUMO, Japan, Catalog No. NN-2719S) with a 1-ml syringe, and finally suspended in phosphate-buffered saline (PBS; NaCl, KCl, Na2HPO4, KH2PO4; Wako).
The cell suspension was extracted into a glass needle (Drummond Scientific Company, Broomall, Pennsylvania, USA, Catalog No. 1-000-0300) and then injected into the abdomen of young adult female flies (within 5 days upon eclosion) using a NARISHIGE IM300 Microinjector (Narishige Scientific Instrument Lab., Tokyo, Japan) with the following settings: N2 gas fill pressure at 20.0 PSI, injection pressure at 5.0 PSI, and balance pressure at 1.8 PSI. Injected host flies were incubated at 29 °C.
Aida A., Yuswan K., Kawai Y., Hasegawa K., Nakajima Y.I, & Kuranaga E. (2023). Drosophila innate immunity suppresses the survival of xenografted mammalian tumor cells. Scientific Reports, 13, 12334.
+ Open protocol
+ Expand
2

Microinjection and Intravital Imaging of Zebrafish Larvae

Check if the same lab product or an alternative is used in the 5 most similar protocols
Microinjections were performed on larvae at 72 hpf using a Narishige IM-300 Microinjector and pulled thin wall glass capillaries (Harvard Apparatus), administered under anaesthesia by intravenous microinjection through the cardiac sinus venosus (SV) that drains the common cardinal vein (CCV). An injection volume of 1 nL was used for all intravenous injections to minimise disruption to blood volume.
For propidium iodide intravital staining, 1nL 100μg/ml propidium iodide in DPBS was injected immediately following injury at 0.5 hpi. Larvae were then immediately imaged by heartbeat-synchronised light-sheet microscopy at 1 hpi. Injection of recombinant zfIFN-γ-rel (IFN-1.1) (Kingfisher Bioscience) was administered as a single 1nL 132nM dose at 72 hpf. Lyophilised IFN- γ-rel was reconstituted in PBS + 0.1% BSA (carrier protein) and PBS + 0.1% BSA was used as the vehicle control solution. Injections of recombinant zfVegfaa (Kingfisher Bioscience) were administered as single 1nL 0.25 ug/ul doses at 72 hpf (protein reconstituted as above).
Pacific blue tagged 500 kDa dextran (Fina Biosolutions) (dissolved at 5% w/v in DPBS) was injected at 1nL into injured larvae 2 hpi and the heart and pericardial fluid immediately imaged by heartbeat-synchronised light-sheet microscopy.
Bruton F.A., Kaveh A., Ross-Stewart K.M., Matrone G., Oremek M.E., Solomonidis E.G., Tucker C.S., Mullins J.J., Lucas C.D., Brittan M., Taylor J.M., Rossi A.G, & Denvir M.A. (2022). Macrophages trigger cardiomyocyte proliferation by increasing epicardial vegfaa expression during larval zebrafish heart regeneration. Developmental Cell, 57(12), 1512-1528.e5.
+ Open protocol
+ Expand
3

Zebrafish Xenograft Cancer Cell Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
In vivo assays were performed in zebrafish (Danio rerio) embryos by microinjection of PSN-pDNA in xenografted embryos with cancer cells. For the manipulation of the embryos, these were kept in E3 medium with 1× PTU and 5% tricaine metasulfonate, an anaesthetic compound used for zebrafish. The microinjection was carried out with a binocular loupe (SMZ745, Nikon, Japan), the IM 300 Microinjector (Narishige, Japan tures were analysed by ImageJ and quantified by QuantiFish (version 2.1.1). 51 (link) Zebrafish embryos used in the study (120 hpf ) are not considered animals, based on the current EU legislation (Directive 2010/63/EU of the European Parliament and the Council of 22 September 2010) as at this stage of development they are not independently feeding larval forms.
Lores S., Gámez-Chiachio M., Cascallar M., Ramos-Nebot C., Hurtado P., Alijas S., López López R., Piñeiro R., Moreno-Bueno G, & de la Fuente M. (2023). Effectiveness of a novel gene nanotherapy based on putrescine for cancer treatment. Biomaterials science, 11(12).
+ Open protocol
+ Expand
4

Efficient Microinjection of Nucleic Acids

Check if the same lab product or an alternative is used in the 5 most similar protocols
The injection plates were generated by melting 2% agarose with egg water in a 100 mm petri-dish, and the injection mold was floated with 0.9 mm width 1.0 mm height (AM6540-0904-1, IPN-Factory, Hekinan, Japan). For injection needle preparation, a glass capillary (G-1, Narishige, Tokyo, Japan) was pulled by one-step pulling using a PC-10 puller (Narishige), and the tip of the capillary was slightly broken off. RNA and DNA solutions were introduced into the needle using a microloader (5242956003, Eppendorf) and injected using an IM 300 microinjector (Narishige).
Oginuma M., Nishida M., Ohmura-Adachi T., Abe K., Ogamino S., Mogi C., Matsui H, & Ishitani T. (2022). Rapid reverse genetics systems for Nothobranchius furzeri, a suitable model organism to study vertebrate aging. Scientific Reports, 12, 11628.
+ Open protocol
+ Expand
5

Targeted Knockdown of lmo2 in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Suppression of lmo2 transcription factor was achieved by using antisense vivo‐Mo 5′‐GTAGAAGCCATTTTCAATATGATTC‐3′ (Gene Tools LLC, Philomath, OR) targeting the LMO2 mRNA translation initiation site. Vivo‐Mo is made by covalently binding a standard Mo to a synthetic scaffold containing guanidinium head groups as a delivery moiety.13 An antisense vivo‐Mo that targets human β‐globin intron mutation 5′‐CCTCTTACCTCATTACAATTTATA‐3 was used as control. Vivo‐Mo was injected into the retro‐orbital vein, as previously described.14 Briefly, zebrafish were anesthetized in tricaine 0.05 mg/mL, and 2 μL of 0.1 mmol/L vivo‐Mo solution was loaded in a glass capillary and injected with a standard microinjector (IM300 Microinjector; Narishige, Tokyo, Japan) on days 0, 2, 4, 6, 8, 10, 12, and 14.
Meng S., Matrone G., Lv J., Chen K., Wong W.T, & Cooke J.P. (2016). LIM Domain Only 2 Regulates Endothelial Proliferation, Angiogenesis, and Tissue Regeneration. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 5(10), e004117.
+ Open protocol
+ Expand
6

siRNA-Mediated Embryonic Knockdown in Bombyx mori

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA-mediated embryonic knockdown was performed as previously described (Kiuchi et al. 2014 (link); Kiuchi and Katsuma 2022 (link)). In brief, ∼5 nL of 100 µM siRNA (FASMAC) was injected into a Bombyx mori N4 strain embryo within 3 h after oviposition using IM 300 Microinjector (Narishige). The embryos were incubated at 25°C in a humidified petri dish for 120 h. Approximately 12 embryos were collected as one sample and total RNA was extracted. siRNA sequences are listed in Supplemental Table 1.
Izumi N., Shoji K., Kiuchi T., Katsuma S, & Tomari Y. (2023). The two Gtsf paralogs in silkworms orthogonally activate their partner PIWI proteins for target cleavage. RNA, 29(1), 18-29.
+ Open protocol
+ Expand
7

Transgenic Zebrafish Embryo Microinjection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adult male and female wild-type (TAB14, AB and TAB5) zebrafish (Danio rerio) were maintained on a 14:10 hour light:dark cycle at 28 °C. Transgenic fish expressing GFP in cardiomyocytes under the cmlc2 promoter (Tg(cmlc2:EGFP)) were generated by constructs contained in the tol2 kit18 (link). Fertilized embryos collected following natural spawning were cultured at 28 °C in fish water (0.6 g/l Crystal Sea Marinemix; Marine Enterprises International, Baltimore, MD) containing methylene blue (0.002 g/l). Needles were calibrated to inject 4 nl per embryo using a Narishige IM-300 microinjector. mRNA encoding Myc-tagged human RAF1 was obtained using mMessage mMachine (Ambion, USA). By titrating mRNA concentrations, 75 ng of RNA injected per embryo was identified as the maximal tolerable and minimal effective concentration. The injections with wild-type and two mutant (p.Pro332Ala and p.Leu603Pro) RAF1 mRNAs were carried out in one-to four-cell-stage embryos. Subsequent experiments were neither randomized nor blinded. The Icahn School of Medicine at Mount Sinai’s Institutional Animal Care and Use Committee approved the necessary ethical protocols regarding zebrafish maintenance, handling and care.
Dhandapany P.S., Razzaque M.A., Muthusami U., Kunnoth S., Edwards J.J., Mulero-Navarro S., Riess I., Pardo S., Sheng J., Rani D.S., Rani B., Govindaraj P., Flex E., Yokota T., Furutani M., Nishizawa T., Nakanishi T., Robbins J., Limongelli G., Hajjar R.J., Lebeche D., Bahl A., Khullar M., Rathinavel A., Sadler K.C., Tartaglia M., Matsuoka R., Thangaraj K, & Gelb B.D. (2014). RAF1 mutations in childhood-onset dilated cardiomyopathy. Nature genetics, 46(6), 635-639.
+ Open protocol
+ Expand
8

Zebrafish Embryonic Manipulation with Morpholinos

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Zebrafish embryos were injected with morpholino antisense oligonucleotides blocking CYP1A or Ahr2 translation, or with a combination of both morpholinos, at the 1-4 cell stage as previously described [29 (link)]. Morpholinos targeting the transcriptional start site of CYP1A (CYP1A-MO; 5- TGGATACTTTCCAGTTCTCAGCTCT -3) [30 (link)] or Ahr2 (Ahr2-MO; 5- TGTACCGATACCCGCCGACATGGTT-3) [31 (link)] and control morpholinos (Ctrl-MO; 5- CCTCTTACCTCAGTTACAATTTATA-3) were obtained from Gene Tools (Philomath, OR, USA). The morpholinos were diluted in sterile-filtered deionized water to 0.15 mM (CYP1A-MO), 0.18 mM (Ahr2-MO) and 0.15/0.18 mM (Ctrl-MO) respectively. For injection of the combination of CYP1A-MO and Ahr2-MO morpholinos with twice the concentration was prepared. A Narishige IM-300 microinjector (Narishige, Tokyo, Japan) with a fine glass needle was used to inject 3-5 nL of morpholinos into the yolk of the embryos. All morpholinos were fluorescein-tagged and embryos were screened at 6-8 hpf by fluorescence microscopy to verify successful incorporation. Any damaged embryos or those not displaying homogenous fluorescence were removed. In addition to the MO-injected groups, groups of non-injected (NI) embryos were used.
Wincent E., Kubota A., Timme-Laragy A., Jönsson M.E., Hahn M.E, & Stegeman J.J. (2016). Biological effects of 6-formylindolo[3,2-b]carbazole (FICZ) in vivo are enhanced by loss of CYP1A function in an Ahr2-dependent manner. Biochemical pharmacology, 110-111, 117-129.
+ Open protocol
+ Expand
9

Knockdown of Adi_bra in Acropora Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately 0.1 nL of 0.5 mM FITC-labeled MO (purchased from Gene Tools) was injected into Acropora embryos using an IM-300 microinjector (Narishige). Successfully injected embryos were sorted using a fluorescence stereomicroscope (Leica M205 FA). The Adi_bra MO sequence is 5 0 -GCATGGTTTACGATGTCTTC CACTC-3 0 (the antisense start codon is underlined). For control MO, standard MO (Gene Tools) was used.
Transcriptome Analysis with RNA-Seq Total RNA was extracted using ISOGEN (Wako) from about 50-100 A. digitifera embryos that had been injected with MO at 32 hpf (hours post-fertilization; late-gastrula stage). RNA-seq was performed using an Illumina TruSeq kit and a GAIIx sequencer.
Yasuoka Y., Shinzato C, & Satoh N. (2016). The Mesoderm-Forming Gene brachyury Regulates Ectoderm-Endoderm Demarcation in the Coral Acropora digitifera. Current biology : CB, 26(21).
+ Open protocol
+ Expand
10

Xenopus Embryo Microinjection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
All animal experiments were as approved by the UCLA Animal Research Committee. Xenopus laevis embryos were fertilized in vitro using excised testis, and staged as described (Colozza and De Robertis 2014 (link); Tejeda-Muñoz and De Robertis, 2022a). In vitro synthesized mRNAs were introduced into embryos by microinjection using an IM 300 Microinjector (Narishige International USA, Inc) of 4 nl into the marginal zone of a ventral blastomere at the 4-cell stage. pCS2-DN-GSK3β, β-catenin, and DN-Rab7 were linearized with NotI and transcribed with SP6 RNA polymerase using the Ambion mMessage mMachine kit. Embryos were injected in 1x MMR and cultured in 0.1x MMR.
Tejeda-Muñoz N., Azbazdar Y., Monka J., Binder G., Dayrit A., Ayala R., O’Brien N, & De Robertis E.M. (2023). The PMA Phorbol Ester Tumor Promoter Increases Canonical Wnt Signaling Via Macropinocytosis. bioRxiv.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!