Log In Sign up
The largest database of trusted experimental protocols

Biacore x100 system

Manufactured by GE Healthcare
Visit Supplier
Sourced in United States, United Kingdom

The Biacore X100 system is a label-free interaction analysis instrument used for real-time monitoring and quantification of biomolecular interactions. The system utilizes surface plasmon resonance (SPR) technology to detect and analyze the interactions between various biological molecules, such as proteins, peptides, small molecules, and macromolecules, without the need for labeling.

Automatically generated - may contain errors

Lab products found in correlation

Cm5 sensor chip, by GE Healthcare (5 mentions) Sensor chip sa, by GE Healthcare (3 mentions) Amine coupling kit, by GE Healthcare (2 mentions) Cm7 chip, by GE Healthcare (2 mentions) Biacore x100 evaluation software, by GE Healthcare (2 mentions) 6 amino 6 deoxy β cyclodextrin, by Cyclolab (2 mentions) Amino dextran, by Thermo Fisher Scientific (2 mentions) Biotin capture kit, by GE Healthcare (2 mentions) Human alpha thrombin solution, by Prolytix (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Bovine serum albumin (bsa), by Merck Group (1 mentions) Active cm7 chip, by GE Healthcare (1 mentions) Human antibody capture kit, by GE Healthcare (1 mentions) Fibronectin, by Merck Group (1 mentions) Br100399, by GE Healthcare (1 mentions) Ez link sulfo nhs lc biotin kit, by Thermo Fisher Scientific (1 mentions) Biacore evaluation software, by GE Healthcare (1 mentions) Anti human igg fc antibody, by GE Healthcare (1 mentions) Nta chip, by GE Healthcare (1 mentions) Bg biotin, by New England Biolabs (1 mentions)

40 protocols using biacore x100 system

1

Measuring Thrombin Binding Affinity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The value of KD for chosen TBA variants was measured using a BIAcore X100 system (GE Healthcare Life Science), human alpha-thrombin solution (Haematologic Technologies), commercially available Biotin CAPture KIT, and Sensor Chip SA (GE Healthcare Life Science). The 5′-biotinylated oligonucleotides were dissolved in a running buffer, 10 mM PBS (138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.76 mM KH2PO4, 0.05% Tween 20 [pH 7.4]), to achieve a sample concentration of 1 μM. The samples were denatured at 95°C for 6 min and then cooled to room temperature overnight. The oligonucleotides were immobilized on a chip surface via the streptavidin-biotin coupling method. The flow rate was set to 30 μL/min, and the unbound oligonucleotide was removed by the treatment with 50 mM aqueous NaOH. Next, serially diluted thrombin solution in the concentration range of 12.5 to 200 nM along with a BSA (Sigma-Aldrich) and sample with only running buffer were injected. The measurements were performed at 25°C. After each run, the system was regenerated by treatment with 50 mM aqueous NaOH. Data analysis was performed using the BIAcore X100 Evaluation software and a 1:1 binding mode.
Kotkowiak W., Lisowiec-Wachnicka J., Grynda J., Kierzek R., Wengel J, & Pasternak A. (2017). Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative. Molecular Therapy. Nucleic Acids, 10, 304-316.
+ Open protocol
+ Expand
2

Detecting PFKL-Penfluridol Interaction

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
A Biacore X100 system (GE Healthcare Life Sciences, Marlborough, MA, USA) was used to detect the interaction between PFKL and penfluridol as described previously16 (link). Briefly, PFKL protein was immobilized on an active CM7 chip (GE Healthcare Life Sciences). Different concentrations of penfluridol was dissolved in the running buffer and passed over the chip at a certain flow rate, and the Kd value was analyzed.
Zheng C., Yu X., Liang Y., Zhu Y., He Y., Liao L., Wang D., Yang Y., Yin X., Li A., He Q, & Li B. (2021). Targeting PFKL with penfluridol inhibits glycolysis and suppresses esophageal cancer tumorigenesis in an AMPK/FOXO3a/BIM-dependent manner. Acta Pharmaceutica Sinica. B, 12(3), 1271-1287.
+ Open protocol
+ Expand
3

SPR Analysis of SARS-CoV-2 Antibody Binding Kinetics

Check if the same lab product or an alternative is used in the 5 most similar protocols
The binding affinity (KD), association rate (ka) and dissociation rate (kd) of purified MAbs to S-ECD or RBD protein were determined by SPR using a Biacore X100 System (GE Healthcare). Anti-human Fc IgG antibody was first immobilized on a CM5 chip to approximately 6,000 response units (RUs) by covalent amine coupling using a human antibody capture kit (GE Healthcare). Purified MAbs were captured on channel 2 of the CM5 chip to approximately 200 RUs. Five 2-fold serial dilutions of the S-ECD protein starting at 40 μg/ml were injected at a rate of 20 μl/min for 90 s with a 300-s dissociation. The chip was regenerated by injection of 3 M MgCl2 for 30 s. All experiments were performed at room temperature, and data were analyzed using Biacore X100 evaluation software (version 2.0.1). Curves were fitted to a 1:1 binding model to determine kinetic rate constants (ka and kd). KD values were calculated from these rate constants. To test the nCoV617 and ACE2 competition for binding to RBD, the RBD was covalently immobilized on a CM5 sensor chip and first saturated with antibody and then flowed through with soluble ACE2.
Yang M., Li J., Huang Z., Li H., Wang Y., Wang X., Kang S., Huang X., Wu C., Liu T., Jia Z., Liang J., Yuan X., He S., Chen X., Zhou Z., Chen Q., Liu S., Li J., Zheng H., Liu X., Li K., Yao X., Lang B., Liu L., Liao H.X, & Chen S. (2021). Structural Basis of a Human Neutralizing Antibody Specific to the SARS-CoV-2 Spike Protein Receptor-Binding Domain. Microbiology Spectrum, 9(2), e01352-21.
+ Open protocol
+ Expand
4

SPR Assay for Polyamide-Oligonucleotide Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following biotin‐conjugated mismatched tRNAleu‐A and matched tRNAleu‐G oligonucleotides were used: mismatched tRNAleu‐A sequence, biotin‐5’‐GATGGCAGAGCCCGGTAATCGTTTTCGATTACCGGGCTCTGCCATC‐3’; matched tRNAleu‐G, biotin‐5’‐GATGGCAGGGCCCGGTAATCGTTTTCGATTACCGGGCCCTGCCATC‐3’ (the underlines show the sequences of interest). Each oligonucleotide was annealed and used for the biosensor‐SPR assay. The kinetic measurements of the curves of polyamide binding to the biotin‐labeled oligonucleotides and data processing were performed on a Biacore X100 system (GE HealthCare) as described previously.24
Koshikawa N., Yasui N., Kida Y., Shinozaki Y., Tsuji K., Watanabe T., Takenaga K, & Nagase H. (2021). A PI polyamide–TPP conjugate targeting a mtDNA mutation induces cell death of cancer cells with the mutation. Cancer Science, 112(6), 2504-2512.
+ Open protocol
+ Expand
5

Fibronectin Binding Kinetics Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
A Biacore X100 system (GE Healthcare) was used for all biosensor experiments. Fibronectin (Sigma) (approximately 1800 resonance units (RU)) was immobilized on flow cell 2 of a CM5 Sensor Chip by amine coupling using an Amine Coupling Kit (GE Healthcare). To record the association and dissociation curves, varying concentrations of subunit were injected into flow cell 2 of the chip for 3 min followed by flushing of the cell with 10 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% Tween 20 (HBS-EP) for 3 min at a flow rate of 10 ml min−1. Identical samples were injected over a control flow cell to determine non-specific binding, which was subtracted from the experimental curves. The sensor chip was regenerated with 0.1% SDS. The equilibrium constants were determined by applying a one receptor binding model, using the Biacore X100 evaluation software and Simfit/HLFIT program.
Berry A.A., Yang Y., Pakharukova N., Garnett J.A., Lee W.C., Cota E., Marchant J., Roy S., Tuittila M., Liu B., Inman K.G., Ruiz-Perez F., Mandomando I., Nataro J.P., Zavialov A.V, & Matthews S. (2014). Structural Insight into Host Recognition by Aggregative Adherence Fimbriae of Enteroaggregative Escherichia coli. PLoS Pathogens, 10(9), e1004404.
+ Open protocol
+ Expand
6

Surface Plasmon Resonance Analysis of MEST

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The experiment was performed as previously described.26 (link) SPR analysis was performed using the Biacore X100 system (GE Healthcare Life Sciences, Marlborough, MA, USA). The MEST protein was immobilized by amine coupling onto flow cell 2 of a CM7 chip (GE Healthcare Life Sciences). Following immobilization, the chip was washed for 30 min with PBS buffer. Small molecules in PBS buffer were passed over the chip at 30 μl/min for 90 s at 25 °C.
Xu W.W., Liao L., Dai W., Zheng C.C., Tan X.P., He Y., Zhang Q.H., Huang Z.H., Chen W.Y., Qin Y.R., Chen K.S., He M.L., Law S., Lung M.L., He Q.Y, & Li B. (2023). Genome-wide CRISPR/Cas9 screening identifies a targetable MEST-PURA interaction in cancer metastasis. eBioMedicine, 92, 104587.
+ Open protocol
+ Expand
7

Quantifying CRM1-p53 Binding Kinetics

Check if the same lab product or an alternative is used in the 5 most similar protocols
Surface plasmon resonance analysis was performed with Biacore X100 system (GE Healthcare). Recombinant CRM1 and p53 protein were immobilized on an activated CM5 dextran chip (GE Healthcare, BR100399), respectively. The binding of TPR at different concentrations in the presence or absence of TLNC1 was performed with PBS containing 500 mM NaCl (pH 7.4) and 0.1% Tween 20. The flow rate was set at 30 μL/min. The binding kinetics was analyzed by BIAevaluation software using the 1:1 L binding model.
Yuan K., Lan J., Xu L., Feng X., Liao H., Xie K., Wu H, & Zeng Y. (2022). Long noncoding RNA TLNC1 promotes the growth and metastasis of liver cancer via inhibition of p53 signaling. Molecular Cancer, 21, 105.
+ Open protocol
+ Expand
8

Quantifying Cyclodextrin Binding Affinities

Check if the same lab product or an alternative is used in the 5 most similar protocols
The binding strength between γ-CD monomer with Dox, cholesterol, and albumin was measured experimentally through surface plasmon resonance (SPR) with a Biacore X100 system (GE Healthcare Bio-Sciences, Pittsburgh, PA). Conditions used were based upon previous optimization for small molecule drugs binding to cyclodextrins 32 , 33 (link). The surface of a sensor chip CM-3 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy γ-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4). The remaining functional groups were capped with ethanolamine. A multi-cycle kinetic experiment was performed separately with the following solutions and running buffers: Dox in diH2O, albumin in diH2O, and cholesterol in 10% ethanol and diH2O. The surface was regenerated with 50 mM sodium hydroxide between samples to fully dissociate any remaining bound analyte. The differential responses between the channels were fit to both steady state affinity and a 1:1 kinetics binding model using Biacore evaluation software. Goodness of fit was verified by U-value <25 as specified in the manufacturer’s instructions.
Rohner N.A., Dogan A.B., Robida O.A, & von Recum H.A. (2019). Serum Biomolecules Unable to Compete with Drug Refilling into Cyclodextrin Polymers Regardless of Form. Journal of materials chemistry. B, 7(35), 5320-5327.
+ Open protocol
+ Expand
9

Surface Plasmon Resonance Analysis of Decorin Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Interaction between the recombinant proteins and bovine decorin (Sigma, D8428) was studied by surface plasmon resonance (SPR) using a Biacore® X100 system (GE Healthcare). Bovine decorin was biotinylated using EZ-Link™ Sulfo-NHS-LC-Biotin kit (ThermoFischer Scientific) and immobilized on a SA sensor chip (GE Healthcare). The amount of immobilized decorin corresponded to 268 Response Units (RU). A separate flow channel on the same sensor chip, reserved for control runs, was prepared in the same way but with biotinylated BSA, immobilized at a level of 685 RU. Analytes were injected in dilution series at 25 °C and at a flow rate of 20 μL.min−1. Between each injection, surfaces were regenerated by 2 washes with 5 μL of 2 M NaCl followed by 1 wash with 1 M NaCl/50 mM NaOH. All curves were corrected for nonspecific binding by subtraction of control curves obtained from injection of the corresponding protein through the blank flow channel. Kinetic constants were determined following a 1:1 binding curve fitting.
Gangnard S., Chêne A., Dechavanne S., Srivastava A., Avril M., Smith J.D, & Gamain B. (2019). VAR2CSA binding phenotype has ancient origin and arose before Plasmodium falciparum crossed to humans: implications in placental malaria vaccine design. Scientific Reports, 9, 16978.
+ Open protocol
+ Expand
10

SPR Analysis of rhDLL4 Binding Kinetics

Check if the same lab product or an alternative is used in the 5 most similar protocols
The binding kinetics of HCLC or H3L2 to rhDLL4 were analyzed using an Surface Plasmon Resonance (SPR)-based assay on Biacore X100 system (GE Healthcare, Buckinghamshire, UK). An anti-human IgG Fc antibody (GE Healthcare, Buckinghamshire, UK) was firstly immobilized onto a CM5 biosensor chip. Then, appropriate concentration of HCLC or H3L2 was captured to the surface with an increase of Resonance Unit (RU) up to 2,000. Finally, various concentrations of rhDLL4 were passed through the chip. After each reaction, the captured HCLC or H3L2 antibody and analyte were removed by Regeneration (3 M magnesium chloride). The whole reaction was conducted at 25 °C and flow rate of 30 μl/min. Sensorgrams of each concentration were obtained and analyzed by Biacore evaluation software (GE Healthcare, Buckinghamshire, UK). The equilibrium constant KD was calculated from ratio of dissociation rate constant kd to association rate constant ka (kd/ka).
Jia X., Wang W., Xu Z., Wang S., Wang T., Wang M, & Wu M. (2016). A humanized anti-DLL4 antibody promotes dysfunctional angiogenesis and inhibits breast tumor growth. Scientific Reports, 6, 27985.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!