Quantstudio 3d digital pcr chip loader

CMV particles were added to a premix containing reverse transcriptase, primers, and a probe with master mix containing DNA polymerase, dNTP, buffer (Tris-HCl, KCl, MgCl₂, pH8.5), etc. The reverse transcriptase and master mix used were RocketScript™ reverse transcriptase, RNase H minus (Bioneer), and QuantStudio™ 3D Digital PCR Master Mix v2 (Thermo Fisher Scientific), respectively. The prepared reaction solution containing CMV particles was injected into a loading blade, loaded onto a digital PCR chip (QuantStudio™ 3D Digital PCR 20 K Chip Kit v2, Thermo Fisher Scientific) comprising sub-nanoliter-sized chambers using a QuantStudio™ 3D Digital PCR Chip Loader (Thermo Fisher Scientific) and sealed.

Chip-based dPCR was performed on a QuantStudio 3D Digital PCR System platform composed of the QuantStudio 3D Instrument (Thermo Fisher Scientific; 4489084), the Dual Flat Block GeneAmp PCR System 9700 (Thermo Fisher Scientific; 4484078), and the QuantStudio 3D Digital PCR Chip Loader (Thermo Fisher Scientific; 4482592). dPCR was performed according to the manufacturer’s instructions. In particular, enzyme activation was performed at 96 °C for 10 min, denaturation at 98 °C for 30 s, followed by annealing/extension at 56 °C for 2 min (40 cycles), and then final extension at 60 °C for 2 min. Analysis was executed with the online version of the QuantStudio 3D AnalysisSuite (Thermo Fisher Cloud, Waltham, MA, USA). The evaluated copy numbers for each miRNA are expressed as the mean of Log10 of the copy number/µL within a 95% confidence interval (CI). Upper and lower limits of the 95% CI are indicated within square brackets.
Primers and probes purchased from Thermo Fisher Scientific were labelled with FAM dyes and used to evaluate the expression of candidate miRNAs (Supplementary Table S1).

For the dPCR analysis, a TaqMan® Custom SNP Genotyping Assays, containing two primers (Ex2_p_KCNJ5_F: CTGCCTTCTTGTTCTCCATCGA, Ex2_p_KCNJ5_R: TCTGGACACTTCTCGGTGATCA) and two probes (VIC-labeled Ex2_p_KCNJ5_V: ACGACCATCGGGTACG and FAM-labeled Ex2_p_KCNJ5_M: ACGACCATCAGGTACG) were used. The reaction volume of 14.5 μL, containing 7.25 μL QuantStudio3D Digital PCR Master Mix v2 (ThermoFisher Scientific), 0.725 μL SNP assay, 1.525 μL nuclease-free water, and 5 μL diluted genomic DNA was loaded onto the chip using the QuantStudio™ 3D Digital PCR Chip Loader, and chips were thermocycled under the standard thermocycling conditions recommended by the supplier (Pro Flex 2 × Flat PCR-System PCR Method), but with 45 cycles. Afterwards, the chips were analyzed by the QuantStudio 3D Digital PCR Instrument and the rare mutation analysis.

30 ng/μL of each alcohol exposure sample was tested with three TaqMan Pri-miRNA assays (Mm04227702 pri-mmu-mir-9-1, Mm03306269 pri-mmu-mir-9-2, and Mm03307250 pri-mmu-mir-9-3) (Thermo Fisher Scientific Inc.). 1μL of each sample was added to 10 μL QuantStudio 3D Digital PCR Master Mix, 1 μL of TaqMan Assay (20X), and 8 μL of nuclease-free water for 20 μL of the reaction mix. 14.5 μL of reaction mix was loaded on each QuantStudio 3D Digital PCR 20K Chip (Thermo Fisher Scientific Inc.) using QuantStudio 3D Digital PCR Chip Loader (Thermo Fisher Scientific Inc.) according to manufacturer’s instruction. The digital PCR was performed on Proflex 2x Flat PCR System (Thermo Fisher Scientific Inc.) with thermal cycling of 10 min at 96°C, followed by 39 cycles at 60°C for 2 min and 98°C for 30 s, followed by holding at 60°C for 2 min and 10°C for long term. Each chip fluorescence intensity was read using QuantStudio 3D Digital PCR instrument (Thermo Fisher Scientific Inc.) and analyzed copies/μL based on Poisson distribution using QuantStudio 3D Analysis Suite Cloud Software (Thermo Fisher Scientific Inc.).

The karyoplasts of spindle–chromosomal complex and pronuclei were isolated and lysed using a REPLI-g Single Cell Kit (150345, Qiagen, Hilden, Germany). The lysate of pronuclei was diluted 10 times before digital PCR (dPCR), while the lysate of the spindle–chromosomal complex was not diluted. A target template spanning nt16413–nt16481 of mtDNA was chosen, which was present only in mtDNA but not in nuclear DNA, and was verified in NCBI Primer BLAST. The primer sequences used were (5′ to 3′): GAAATCAATATCCCGCACAAGAG (forward) and TTAGCTACCCCCAAGTGTTATGG (reverse) with a TaqMan probe sequence of 5-FAM-ACTCTCCTCGCTCCGG-MGB-3 (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) designed using Primer Express software (v3.0, Thermo Fisher Scientific, South San Francisco, California, USA). The quantification of mtDNA was performed as we described previously (Wang et al., 2014 (link)). The sample was loaded using the QuantStudio 3D Digital PCR Chip Loader (4482592, Thermo Fisher Scientific, Singapore) and amplified in a GeneAmp PCR System 9700. Images of chips were taken using the QuantStudio 3D Digital PCR System (Thermo Fisher Scientific, Singapore) and analyzed with QuantStudio 3D AnalysisSuite software (v1.1, Thermo Fisher Scientific, Carlsbad, CA, USA).