Sybr green real time pcr mix

To measure the level of mRNA expressions, real-time PCR was performed using the StepOnePlus system (Applied Biosystems, Foster City, CA) as described previously (Haraguchi et al., 2010 (link); Haraguchi et al., 2012b (link); Haraguchi et al., 2012b (link); Haraguchi et al., 2015 (link); Nozaki et al., 2018 (link)). The sequence of each primer is shown in Table 1. Gapdh was used as the internal standard. The reaction mixture contained SYBR Green Real-Time PCR Mix (Toyobo, Osaka, Japan), 400 nM of forward and reverse primers, and 30 ng of cDNA in a final volume of 20 μL. PCR was run with a standard cycling program: 95°C for 3 min; 40 cycles of 95°C, 15 s; 60°C, 15 s; and 72°C, 15 s. An external standard curve was generated by a serial 10-fold dilution of cDNA obtained from the salmon brain, which had been purified, and its concentration was measured. To confirm the specificity of the amplification, the PCR products were subjected to melting curve analysis and gel electrophoresis. The results were normalized to the expression of gapdh using StepOnePlus 2.0 software (Applied Biosystems).

Total RNA was extracted from CRC cells using TRIzol reagent according to the manufacturer’s instructions. Then cDNA was synthesized using the Reverse Transcription Kit (TOYOBO, Japan). qPCR assay was conducted using SYBR Green Real-time PCR Mix (Toyobo, Japan) and determined in triplicate. Data were normalized to GAPDH expression. The 2^−ΔΔCt method was calculated to represent the relative expression level of the gene. All primers were obtained from Sangon Biotech (Shanghai, China). The conditions of RNA reverse transcription and qPCR assay were listed in Additional file 1: Table S12. The primers used for RT-PCR and qPCR amplification were listed in Additional file 1: Table S13.

Samples (5 ± 0.10 mg) of intestine, gill, brain, heart, kidney, spleen, and liver were collected from fish and homogenized in lysis buffer. Total RNA of YcCV were extracted using TRIzol reagent (Invitrogen, USA), according to the manufacturer’s instructions. The RNA was reverse transcribed to cDNA using a PrimeScript first-strand cDNA synthesis kit (TaKaRa, Japan). The copy numbers of the YcCV in different tissues were examined using qPCR with normalized cDNA as the template. A SYBR green real-time PCR mix (ToYoBo, Osaka, Japan) and the Rotor-Gene Q real-time PCR detection system (Qiagen, Hilden, Germany) were used to perform qPCR following the manufacturer’s protocols. The qPCR cycle conditions were 95°C for 10 min followed by 40 cycles of 95°C for 10 s, 60°C for 1 min, and 72°C for 30 s, using the primers (YcCV-Fq–YcCV-Rq) listed in Table 1. The experiment was performed three times independently.

TRIzol reagent (Invitrogen, California, USA) was used to extract total RNA from HS tissues or cell samples. Then cDNA was synthesized using RevertAid Reverse Transcriptase (Thermo Fisher Scientific, Waltham, USA). mRNA expression levels were quantified using a SYBR Green Real-time PCR Mix (Toyobo, Osaka, Japan) and threshold cycles (Ct) values were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. The expression of miR-203a-3p was quantified by a fast real-time PCR system (7900 HT, ABI, CA) and Ct values were normalized to U6 expression. The relative expression levels were determined according to the 2^{−ΔΔ CT} method. The sequences of primers used for PCR amplification are listed in Tables S3 and S4, see online supplementary material.

Total RNA was prepared from each tissue using an RNase-free RNA preparation kit (Qiagen, Hilden, Germany) as described previously [23 (link)]. First-strand cDNA was synthesized from 1 μg of total RNA using a ReverTra Ace cDNA synthesis kit (Toyobo) with an oligo-dT (20) primer. Real-time quantitative PCR was performed as described previously [24 (link)] with SYBR Green real-time PCR mix (Toyobo) and a PCR machine. The levels of the OsMac1 transcripts, β-glucuronidase (GUS) transcripts, and Actin1 (AK100267) transcript were monitored by pairs of gene-specific primers: 5’–TCACATCTCCCTCAAGCTA–3’ and 5’–CACGGTAGTATTCAACTGCTTG–3’, 5’–GCCGATGCAGATATTCGTA–3’ and 5’–CCATCACTTCCTGATTATTGA–3’, and 5’–CCCTCCTGAAAGGAAGTACAGTGT–3’ and 5’–GTCCGAAGAATTAGAAGCATTTCC–3’, respectively.

Total RNA was isolated using TRIzol® RNA Isolation Reagents (Thermo Fisher Scientific) according to the manufacturer’s instructions. The reverse transcription was conducted with 1 µg of total RNA using the ReverTraAce cDNA Synthesis kit (TOYOBO). Quantitative real-time polymerase chain reaction (PCR) was performed using a CFX96 Thermal Cycler (Bio-Rad) in 10 µl of reaction mixtures containing cDNA, SYBR Green Real-time PCR Mix (TOYOBO) and primers at final concentrations of 500 nM. For normalization of target gene expression levels, ratios relative to the housekeeping gene GAPDH were calculated using the comparative CT method (ΔΔCT). The primers used for qRT-PCR are listed in Supplementary Table 1.