Gel extraction kit

RNAiso Plus Reagent (TaKaRa, Kusatsu, Japan) was used to isolate total RNA from hepatopancreas tissue according to the manufacturer’s protocol. The reverse transcriptase M-MLV Kit (TaKaRa, Kusatsu, Japan) was used to synthesize first-strand cDNA, and 3′-rapid amplification of cDNA ends (RACE) was performed using a 3′-full RACE Core Set Ver. 2.0 Kit (TaKaRa, Kusatsu, Japan) to determine the 3′ ends of MnGST-1 and MnGST-2. All primers used for cloning are listed in Table 1. Polymerase chain reaction (PCR) products were purified using a gel extraction kit (CWBIO, Beijing, China) and sequenced using an ABI3730 DNA analyzer (ABI, Tampa, FL, USA) after insertion into the PMD-18T vector (TaKaRa, Kusatsu, Japan).

Isolation of tsGAPDH cDNA sequence was carried out by 3′ and 5′ rapid amplification of cDNA ends (RACE) technology. In brief, total RNA was isolated from blood samples using the TRIzol Reagent (Life Technologies). The absorbance at 260 nm and 280 nm was measured using Take3 model in epoch plate reader (Biotek) to determine the concentration of RNA. First-strand cDNA was synthesized using the SMARTer RACE cDNA Amplification Kit (Clontech). Based on the published nucleotide sequences of the partial tree shrew GAPDH gene (Genbank AY699815.1), we designed 2 gene-specific primers (GSP) for 5′-RACE and 3′-RACE reaction, separately (Table 2). The 5′-RACE and 3′-RACE amplifications were preformed using LA Taq (TaKaRa). PCR products was electrophoresed on 1% agarose gel, and then purified using the Gel Extraction Kit (CWBio). Subsequently, RACE products were cloned into the pMD-18T Vector (TaKaRa) in accordance with established protocols, and then constructed plasmids were sequenced (Life Technologies).

Prime STAR^®GXL DNA Polymerase was purchased from TaKaRa Company (Japan). Restriction enzymes NdeI and XhoI were purchased from NEB (England). RNeasy Mini Kit was purchased from QIAGEN (Gemany). The SuperScript^® III First-Strand Synthesis System was purchased from Invitrogen (USA). SYBR Green kit was purchased from TransGen Biotech (China). Gel extraction kit and plasmid miniprep kit were obtained from the CW Bio Company (China). Ni-NTA agarose were purchased from GE Healthcare (Sweden). Pierce^® BCA Protein Assay Kit was purchased from Thermo Company (USA). Cholesterol, hydrogenated soy phosphatidylcholine (HSPC), mPEG2000-DSPE and mal-PEG2000-DSPE were purchased from Avanti polar lipids (USA). Hoechst 33342 and Dio were purchased from Sigma (USA). The human bladder cancer cell line RT112 and T24 were supported by JENNIO Company (China).

To amplify the complete genome of AGV, PCR assay was carried out as described above, except that primer pair of AGV-F: CGTGTATTGGGTTCTTCAGAC/AGV-R: TGAGCATCGACCTCATTCGG was applied to the PCR amplification and the total DNA above substituted for cDNA as template. The primers were designed based on the sequence flanked by primers AGV-detF/AGV-detR. The PCR products were gel-purified using Gel Extraction Kit (CWBIO, Beijing, China), cloned into pMD18-T simple vector (TaKaRa, USA), and Escherichia coli JM109 competent cells were transformed. Selected clones (three per amplicon) were sequenced at GENEWIZ, Inc., Beijing, China.
The full-length genome sequences were assembled using Vector NTI (Invitrogen) based on overlapping regions, and the ORFs were identified using ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder, accessed on 15 May 2022). SDT 1.0 [25 (link)] was used to determine pairwise nucleotide sequence identities and amino acid sequences among different isolates.

Total RNA was extracted using RNAprep Pure Extraction Kit (DP441, TIANGEN biochemical Technology, Beijing, China) and checked the quality and integrity by the 1.0% agarose gel electrophoresis analysis. And the first strand of cDNA was synthesized by PrimeScript RT reagent Kit with gDNA (RR047, TaKaRa, Tokyo, Japan) according to the instructions. The specific primers were designed using Permier Primer 6.0 based on the sequences from the transcriptome data (Table S1). The HvDFR gene was amplified from the cDNA with primers using TaKaRa Taq™ (R001A, TaKaRa, Tokyo, Japan), with the following cycle conditions: initial denaturation at 94◦C for 3 min, dolllowed by 33 cycles of denaturation at 94◦C for 30s, annealing at 58◦C for 30s, and extension at 72◦C for 30s, and a final extension at 72◦C for 10 min. The PCR fragments were obtained and purified with Gel Extraction Kit (CW2302 CWBIO,JiangSu,China), and then cloned into a pMD™ 18-T Vector Cloning Kit (6011 Takara, Tokyo, Japan) and sequenced by GENE Biotechnology company (Beijing, China). The conserved domain of the candidate gene was predicted on the NCBI Conserved Domain Database (https://www.ncbi.nlm.nih.gov/structure/cdd/wepsb.cgi). The alignment analysis of DFRs were employed with DNAMAN and a phylogenetic tree was constructed with MEGA 7.0 using the Nerghbor-Joining method and 1000 bootstrap replicates.

The following antibodies were used throughout this study: from Abclonal (Wuhan, China), anti-FLAG (AE063), anti-HA (AE036), anti-ASGR1 (A13279), anti-β-Actin (AC026). From Abcam (Cambridge, UK), anti-ASGR1 (ab254262). From proteintech (Wuhan, China), anti-ACE2 (21115-1-AP). From Sino Biological (Beijing, China), rabbit-anti-SARS-CoV-2 NP antibody. From R&D systems (UMN, USA), anti-His-Alexa Fluor488-conjugated Antibody (IC050G). Anti-Flag Magnetic Beads (HY-K0207) and ACE2/ANG (1-7) inhibitor-A779 (HY-P0216) were purchased from MCE. The Sipke of SARS-CoV-2 (DRA59) was purchased from novoprotein (Shanghai, China). 2× Taq Master Mix (P112) and High-fidelity PCR enzyme-2× Phanta Max Master Mix (P515) were purchased from Vazyme (Nanjing, China). PMD18-T (6011) was purchased from Takara (Beijing, China). Cell Genome Extraction Kit (DP304) and Plasmid Extraction Kit (DP103, DP108, DP117) were purchased from Tiangen (Beijing, China). Gel Extraction Kit (CW2302) was purchased from CWBIO (Nanjing, China). Luciferase detection kit (E6110) was purchased from Promega (Madison, USA). Cell Counting Kit (CCK-8) and TUNEL Apoptosis Detection Kit (FITC) were purchased from Yeasen (Shanghai, China).