Quantitect reverse transcript kit

qPCR analysis was performed by first isolating total RNA using Trizol/Chloroform and isopropanol precipitation from freshly isolated DRG neurons (Life Technologies). Generation of cDNA was achieved by Reverse Transcription using the QuantiTect Reverse Transcript Kit (Qiagen). For qPCR, FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run in the Eco Real-Time PCR instrument (Illumina) using 0.5 ul of the cDNA in a 10 ul reaction according to the manufacturer's instructions. Real time Taqman qPCR assays were purchased from Integrated DNA Technologies with a FAM reporter dye and a non-fluorescent quencher: mouse Piezo2 (Mm.PT.56a.32860700, Fam38b), and an internally designed mouse Gapdh assay (forward primer- GCACCACCAACTGCTTAG; reverse primer- GGATGCAGGGATGATGTTC and probe- CAGAAGACTGTGGATGGCCCCTC).
Calibrations and normalizations were done using the 2^-ΔΔCT method, where ΔΔC_T = ((C_T (target gene) -C_T (reference gene)) - (C_T (calibrator) - C_T (reference gene)). Gapdh was used as the reference gene for all qPCR experiments^{33 (link)}.

qPCR analysis was performed as previously described (14 (link)). Briefly, total RNA was extracted using TRIzol/chloroform and isopropanol precipitation from freshly isolated dorsal root ganglion neurons (Life Technologies). Generation of complementary DNA was achieved by reverse transcription using the QuantiTect Reverse Transcript kit (Qiagen). For qPCR, FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run in the Eco RealTime PCR instrument (Illumina) using 0.5 μl of the cDNA in a 10 μl reaction according to the manufacturer’s instructions. Real-time Taqman qPCR assays were purchased from Integrated DNA Technologies with a FAM reporter dye and a non-fluorescent quencher: mouse Piezo2 (Mm.PT.56a.32860700), and an internally designed mouse Gapdh assay (forward primer: GCACCACCAACTGCTTAG; reverse primer: GGATGCAGGGATGATGTTC; and probe: CAGAAGACTGTGGATGGCCCCTC).

For tissue comparison experiments, DRGs were freshly isolated from adult male C57BL/6J mice and snap frozen on dry ice, and total RNA was isolated using Trizol treatment. Total RNA from all other tissues was purchased from Zyagen. For strain comparison experiments, DRGs from different inbred strains were isolated (n=3 mice/sex/strain) and treated similarly. Two hundred ng of total RNA was used to generate the first-strand cDNA using the Quantitect Reverse transcript kit (Qiagen). A real time Taqman PCR assay for Chrna6 (Assay ID: Mm00517529_m1) was purchased from Life Technologies, with a FAM reporter dye and a non-fluorescent quencher. FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run, in triplicate, in the ABI 7900HT fast real time system using 0.5 μl of the cDNA in a 10-μl reaction as per the manufacturer’s instructions.
Calibrations and normalizations were done using the 2^−∆∆CT method. The target gene was Chrna6, while the reference gene was Actb (β-actin). The calibrator for the tissue comparisons was the DRG; the calibrator for the strain comparisons was the DBA/2 strain.