Perfectstart 2 probe qpcr supermix

Approximately, 0.1 g of plant tissue was collected, frozen in liquid nitrogen, and ground in a mortar. Total DNA was extracted from roots, stems, and stem tips following the user manual of the plant genomic DNA extraction kit [Tiangen Biotech (Beijing) Co., Ltd., DP 305]. The DNA content was measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific) and diluted to approximately 100 ng/μL using sterile water. The diluted DNA samples were stored at −20°C until further use.
For the detection of U. esculenta in Z. latifolia, specific probes and primers (Table 1) were designed based on the SNP on the ITS sequences. The primers and probes were synthesized by Nanjing GenScript Biotech Corporation. The qPCR was performed using the following items: 10 μL PerfectStart II Probe qPCR SuperMix (2x; Beijing TransGen Biotech, AQ 711, AQ 401), 1.5 μL T fluorescent probe (10 μmol·L⁻¹), 1.5 μL MT fluorescent probe (10 μmol·L⁻¹), 1.5 μL forward primer ITS-F (10 μmol·L⁻¹), 1.5 μL reverse primer ITS-R (10 μmol·L⁻¹), 1 μL DNA template extracted from Z. latifolia tissues, and 3 μL sterile nuclease-free water. The amplification was carried out for 40 cycles under the following conditions: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 52°C for 15 s, and extension at 72°C for 30 s.

CLas quantification was performed by Real-time PCR with CLas-specific primer set (CLas4G: AGTCGAGCGCGTATGCGAAT/HLBr: GCGTTATCCCGTAGAAAAAGGTAG) and probe (HLBp: FAM-AGACGGGTGAGTAACGCG-BHQ) according to our previous study (Bao et al., 2020 (link)). TaqMan^® quantitative Real-time PCR were performed in CFX Connect Real-Time System (Bio-Rad, Hercules, CA). PCR mixture (20 μL) contained 10 μL of PerfectStart^® II Probe qPCR SuperMix (TransGen Biotech, Beijing), 1 μL of DNA template (~25 ng), 0.4 μL of each forward and reverse primer (10 μM), 0.2 μL of PCR Probe (10 μM) and 8 μL of ddH2O. The procedure of PCR included incubation at 95°C for 2 min followed by 40 cycles of amplification (95°C for 10 s and 58°C for 30 s, with fluorescence signal capture at the end of each 58°C step). PCR result (Ct value) was obtained by using Bio-Rad CFX Manager 2.1 software with automated baseline settings and threshold. DNA Sample with Ct value less than 34 was considered as CLas positive.