The largest database of trusted experimental protocols

Anti ssbp1

Manufactured by FineTest
Sourced in China

Anti-SSBP1 is a laboratory reagent that binds to and inhibits the activity of the SSBP1 (Single-Stranded DNA Binding Protein 1) protein. SSBP1 is involved in DNA replication and repair processes. Anti-SSBP1 can be used in research applications to study the role of SSBP1 in cellular processes.

Automatically generated - may contain errors

2 protocols using anti ssbp1

1

Fabrication of IFI6-PDA@GO/SA Hydrogel

Check if the same lab product or an alternative is used in the 5 most similar protocols
IFI6 was obtained from SAB Co. (Maryland, USA). GO and SA were prepared by RuiXi Materials Tech Co. (Xian, China). Dopamine was obtained from Sigma-Aldrich Co. (Shanghai, China). Anti-IFI6 and anti-phospho-HSF1 were purchased from Bioss Co. (Beijing, China). Anti-SSBP1 was purchased from FineTest Co (Wuhan, China).
To synthesize PDA@GO: 30 mg GO, we added 10 mm Tris buffer (pH 8.5) and placed it in a water bath ultrasound for 2 h. We then added 30 mg DA, stirred at room temperature for 48 h, centrifuged at 8000 rpm for 10 min, washed three times with water and ethanol, and dried at 40 ℃ for 12 h.
We synthesized IFI6- PDA@GO /SA: Dissolve SA in a 100-ml beaker, then added PDA@GO, 50 µl peroxide solution, and horseradish peroxidase. Finally, we added 3 mg IFI6 protein powder into the beaker and stirred for 1 h until the mixture was a hydrogel at room temperature (25 ℃).
+ Open protocol
+ Expand
2

Synthesis and Labeling of miR129

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiO2 and Cerium nitrate was prepared by RuiXi Materials Tech Co. (Xian, China). Anti-IFI6, Anti-HIF-1α was purchased from Bioss Co. (Beijing, China). Anti-SSBP1 was purchased from FineTest Co. (Wuhan, China). miR129 was purchased from GenePharma Co. (Shanghai, China), sense strand: CUUUUUGCGGUCUGGGCUUGC, antisense strand: AAGCCCAGACCGCAAAAAGUU. The end of miR129 is modified by NH2 group and has green fluorescence.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!