Cmrl 1066

Manufactured by Thermo Fisher Scientific

Sourced in United States, Netherlands

CMRL 1066 is a basal medium formulated for the culture of various cell types, including human and animal cells. It provides a complete and balanced set of nutrients required for cell growth and maintenance. The medium is optimized for use in a variety of cell culture applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

CMRL 1066 medium (44 citations) CMRL-1066 media (4 citations) CMRL-1066 (5.6 mM glucose) culture medium (3 citations) CMRL‐1066 culture medium (3 citations)

29 protocols using cmrl 1066

Blastocyst-like Structure Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Briefly, blastocyst-like structures were seeded onto Matrigel (BD, 356234) coated ibidi-u plates and cultured in CMRL 1066 (Thermo Fisher Scientific, 11530037) containing 10% FBS (Millipore, ES-009B), 1 mM sodium pyruvate (Invitrogen, 11360070), 100 units ml⁻¹ penicillin-streptomycin (Thermo Fisher Scientific, 15140–122), 2 mM L-Glutamine (Invitrogen, 25030081), N₂ (Thermo Fisher Scientific, 17502048) and B27 supplement (Invitrogen, 17504044) (IVC1) at 37°C in a humidified atmosphere of 5% CO2. Second day FBS concentration increased to 20% (IVC2).

van Hoogmoed C.G., van der Kuijl-Booij M., van der Mei H.C, & Busscher H.J. (2000). Inhibition of Streptococcus mutans NS Adhesion to Glass with and without a Salivary Conditioning Film by Biosurfactant- Releasing Streptococcus mitis Strains. Applied and Environmental Microbiology, 66(2), 659-663.

+ Open protocol

+ Expand

Generation of Pseudoislets with PLIN2 Knockdown

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human islets from IIDP, Alberta Diabetes Institutes, or Prodo labs (Supplemental Tables 5 and 6) with reported viability and purity above 80% were cultured overnight at 37°C and 5% CO₂ upon arrival for recovery from shipping (9 (link)). Lentivirus carrying scramble (CCTAAGGTTAAGTCGCCCTCG) and shRNA sequence targeting human PLIN2 (CAGAAGCTAGAGCCGCAAATT) obtained from Genetic Perturbation Platform (https://portals.broadinstitute.org/gpp/public) were prepared as previously described (38 (link)). Pseudoislets transduced with lentivirus were created in 96-well spheroid plate (Corning) at 2000 cells/well or Aggrewell 400 (StemCell technologies) at 400 cells/well, as described (58 (link)), and cultured for 1 week in CMRL 1066 (Thermo Fisher Scientific) supplemented with 10% heat-inactivated FBS, 1% penicillin + streptomycin, and 1% L-glutamate (10% HI-FBS CMRL) at 37°C and 5% CO₂ before harvesting.

Mishra A., Liu S., Promes J., Harata M., Sivitz W., Fink B., Bhardwaj G., O’Neill B.T., Kang C., Sah R., Strack S., Stephens S., King T., Jackson L., Greenberg A.S., Anokye-Danso F., Ahima R.S., Ankrum J, & Imai Y. (2021). Perilipin 2 downregulation in β cells impairs insulin secretion under nutritional stress and damages mitochondria. JCI Insight, 6(9), e144341.

+ Open protocol

+ Expand

Murine Pancreatic Islet Isolation and Cytokine Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Islets were harvested from NOD.Rag1^−/− female mice between 7–13 weeks of age, or 5–23 week old NOD mice, as previously described^{50 (link)}. Briefly, 3 ml of ice-cold CIzyme (#005-1030, VitaCyte, Indianapolis, IN) was prepared following manufacturer’s instructions and injected into the common bile duct to inflate the donor pancreata. Pancreata were digested at 37 °C for 17 minutes. Following digestion, islets were washed with HBSS, centrifuged at room temperature at 2000 rpm for 20 min in Lympholyte1.1 (Cedarlane, Burlington, Ontario, CA), washed with 10% fetal calf serum (FCS) (Omega Scientific Inc, Tarzana, CA) in HBSS, and hand-counted. Islets were cultured in CMRL 1066 (Thermo Fisher Scientific) containing 1% Glutamax (Thermo Fisher Scientific), 10% FCS and 1% Pen/Strep (Thermo Fisher Scientific). To determine β cell response to pro-inflammatory cytokines, we supplemented cultures of 100 hand-counted pancreatic islets with murine IFN-γ [50 ng/ml], TNF-α [10 ng/ml], IL-1β [17.5 ng/ml], CXCL10 [20 ng/ml], IL-10 [20 ng/ml], TGF-β [10 ng/ml], IFN-α [10 ng/ml], IL-4 [10 ng/ml], IL-12 [20 ng/ml], and IL-21 [20 ng/ml] in non-tissue culture treated 12-well plates as indicated. All cytokines were purchased from Biotechne (Minneapolis, MN).

Osum K.C., Burrack A.L., Martinov T., Sahli N.L., Mitchell J.S., Tucker C.G., Pauken K.E., Papas K., Appakalai B., Spanier J.A, & Fife B.T. (2018). Interferon-gamma drives programmed death-ligand 1 expression on islet β cells to limit T cell function during autoimmune diabetes. Scientific Reports, 8, 8295.

+ Open protocol

+ Expand

In Vitro Blastocyst/Blastoid Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

We followed previously reported methods (Ma et al., 2019 ). Blastocysts or blastoids were placed in 4-well plates coated with Matrigel (CORNING, 356234) and then cultured with IVC1 for 48 h, which was subsequently replaced with IVC2 for culture for another 48 h. IVC1 was composed of CMRL 1066 (Thermo Fisher Scientific 11530037) containing 10% (v/v) FBS, 1 mmol/L sodium pyruvate, 1× penicillin-streptomycin, 2 mmol/L L-glutamine, 1× N2 supplement, and 0.25× B27 supplement. IVC2 contained 20% (v/v) FBS, and the remaining components were the same as those in IVC1.

Liu K., Xu X., Bai D., Li Y., Zhang Y., Jia Y., Guo M., Han X., Liu Y., Sheng Y., Kou X., Zhao Y., Yin J., Liu S., Chen J., Wang H., Wang Y., Liu W, & Gao S. (2022). Bilineage embryo-like structure from EPS cells can produce live mice with tetraploid trophectoderm. Protein & Cell, 14(4), 262-278.

+ Open protocol

+ Expand

Isolation and Culture of Rat Pancreatic Islets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pancreatic islets were harvested from male Sprague Dawley rats (Charles River) via collagenase digestion as previously described (49 (link)). Isolated islets were cultured in CMRL-1066 (ThermoFisher, Waltham, MA) supplemented with 10% v/v FBS, 2 mM L-glutamine, 100 units/mL penicillin, and 100 μg streptomycin. For RT-qPCR experiments, 60-80 islets were used per treatment condition in 300 μL CMRL-1066. For immunoblot experiments, ~100 islets were used per treatment condition. All studies were conducted in accordance with the GlaxoSmithKline (GSK) Policy on the Care, Welfare, and Treatment of Laboratory Animals and were reviewed by the Institutional Animal Care and Use Committee either at GSK or by the ethical review process at the Medical College of Wisconsin, where the work was performed.

Nord J.A., Wynia-Smith S.L., Gehant A.L., Jones Lipinski R.A., Naatz A., Rioja I., Prinjha R.K., Corbett J.A, & Smith B.C. (2022). N-terminal BET bromodomain inhibitors disrupt a BRD4-p65 interaction and reduce inducible nitric oxide synthase transcription in pancreatic β-cells. Frontiers in Endocrinology, 13, 923925.

+ Open protocol

+ Expand

Analyzing Cellular Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were purchased from Cell Signaling Technologies (Denver, CO, USA): phospho-EGFR, EGFR, p65, phospho-p65, phospho-eIF2a, eIF2a, caspase-3, and cleaved caspase-3 (Table S1). Antibodies to NumbL and TRAF6 were obtained from SantaCruz Biotechnology (Dallas, TX, USA). The sequence of siRNAs (mission siRNAs purchased from Sigma-Aldrich, St. Louis, MO, USA) used against NumbL was 5′-GAACUCACCUUUCAAACGU[dT][dT]-3′] and 5′-ACGUUUGAAAGGUGAGUUC[dT][dT]-3′, and that of Numb was 5′-GAAGACUGAUUUCCCAAUA[dT][dT]-3′ and 5′-UAUUGGGAAAUCAGUCUUC[dT][dT]-3′; MISSION siRNA Universal Negative Control was used as a control. Taqman probes for NumbL, Numb, and Hes-1 genes, cell culture media, RPMI-1640, and CMRL-1066 were obtained from Thermo Fisher Scientific (Waltham, MA, USA). All the other reagents, if not indicated, were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Basavarajappa H.D., Irimia J.M., Bauer B.M, & Fueger P.T. (2023). The Adaptor Protein NumbL Is Involved in the Control of Glucolipotoxicity-Induced Pancreatic Beta Cell Apoptosis. International Journal of Molecular Sciences, 24(4), 3308.

+ Open protocol

+ Expand

Human Pancreatic Islet Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human islet study was reviewed by IRB at University of Iowa and deemed non-human study. Human islets were received from the Alberta Diabetes Institute Islet Core with reported viability and purity above 80%.
Islet were cultured in CMRL1066 (Thermo Fisher Scientific, 11530037) medium with 1% human serum albumin, 1% Pen-Strep (Thermo Fisher Scientific, 15140163), and 1% L-Glutamine (Thermo Fisher Scientific, 25030164) overnight at 37°C upon arrival for recovery upon shipping. The eight donors were: age, 20-69 years; BMI, 19-33.9; Hba1c, 4.9-5.8; males; cause of death, neurological.

Li M., Shao F., Qian Q., Yu W., Zhang Z., Chen B., Su D., Guo Y., Phan A., Song L., Stephens S.B., Sebag J.A., Imai Y., Yang L., & Cao H. (2020). A putative long noncoding RNA-encoded micropeptide maintains cellular homeostasis in pancreatic β-cells.

+ Open protocol

+ Expand

Cell Culture Protocols for Diverse Cell Types

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cells were cultured at 37°C in a humidified 5 % CO₂ atmosphere. HEK293T cells (ATCC, female) used in transcriptional activation, NHEJ, and mCherry-disruption assays were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) supplemented with 10% fetal bovine serum (FBS, Sigma Aldrich) and 1× penicillin/streptomycin/glutamax (Life Technologies). U2OS.eGFP.PEST cells (human, female) stably integrated with an eGFP.PEST fusion gene were maintained in DMEM supplemented with 10% FBS, 1× penicillin/streptomycin/glutamax, and 400 μg/mL G418 (selection antibiotic). WM793 cells (human, male) were cultured in RPMI1640 (Life Technologies) media supplemented with 10% FBS and 1× penicillin/streptomycin/glutamax. Human islets (female) were maintained in CMRL 1066 (Life Technologies) containing 10% FBS, 1× penicillin/streptomycin/glut amax, and 1 mM sodium pyruvate and were cultivated at 37°C with 5% CO₂ in a humidified atmosphere. Human bone marrow-derived mesenchymal stem cells (hMSC, female) were cultured in DMEM supplemented with 10% FBS and 1× penicillin/streptomycin/glutamax. Cells were continuously maintained at <90% confluency. All cell lines were sourced commercially or were functionally validated. Cells were periodically tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).

Maji B., Gangopadhyay S.A., Lee M., Shi M., Wu P., Heler R., Mok B., Lim D., Siriwardena S.U., Paul B., Dančík V., Vetere A., Mesleh M.F., Marraffini L.A., Liu D.R., Clemons P.A., Wagner B.K, & Choudhary A. (2019). A high-throughput platform to identify small-molecule inhibitors of CRISPR-Cas9. Cell, 177(4), 1067-1079.e19.

+ Open protocol

+ Expand

Porcine Islet Transplantation Methodology

Check if the same lab product or an alternative is used in the 5 most similar protocols

All islet preparations were cultured overnight prior to Tx, with the exception of islets from pig P462-04 that were cultured for one week and mixed with a second islet batch (P474-07) cultured overnight (Table 2). Culture was in CMRL-1066 (Life Technologies, Carlsbad, CA) supplemented with 10% heat-inactivated porcine serum, 100units/mL penicillin, 0.1mg/mL streptomycin, and 2mmol/L L-glutamine (all from Life Technologies) at 24°C in 5% CO₂. Prior to Tx, islets were resuspended in fresh 20mL CMRL-1066 medium with the addition of low molecular weight dextran sulfate (4.5mg/kg of recipient, Sigma-Aldrich, St. Louis, MO) (36 (link)). The insulin content of the transplant medium was negligible (<0.5U).
The islets were infused intraportally by gravity over 5-10min. Immediately before islet infusion, anti-inflammatory and anticoagulant treatment was administered (Table 3). Activated clotting time (ACT) was monitored (I-Stat, Abbott, Princeton, NJ) and anticoagulants discontinued if the ACT >190sec (37 (link)). Postoperative treatment consisted of prophylactic cefazolin (10mg/kg i.m. x2 daily) and buprenorphine (0.03mg/kg i.m. x2 daily) for 3 days. Monkeys were allowed to eat on the evening of surgery.

Bottino R., Wijkstrom M., van der Windt D.J., Hara H., Ezzelarab M., Murase N., Bertera S., He J., Phelps C., Ayares D., Cooper D.K, & Trucco M. (2014). PIG-TO-MONKEY ISLET XENOTRANSPLANTATION USING MULTI-TRANSGENIC PIGS. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 14(10), 2275-2287.

+ Open protocol

+ Expand

Immortalized Human Islet Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Freshly purified human islet preparations (n = 5), discarded from transplant use for insufficient islet mass, were cultured, after approval by the local ethical committee, on tissue culture treated flasks in CMRL1066 with 10% FBS (Life Technologies, Carlsbad, CA). After 7 days of culture, cells derived from the outgrowth were transfected with pBR322 plasmid vector containing SV40-T large antigen gene and clones sorted for CD31 and characterized as previously described [20] (link).

Figliolini F., Cantaluppi V., De Lena M., Beltramo S., Romagnoli R., Salizzoni M., Melzi R., Nano R., Piemonti L., Tetta C., Biancone L, & Camussi G. (2014). Isolation, Characterization and Potential Role in Beta Cell-Endothelium Cross-Talk of Extracellular Vesicles Released from Human Pancreatic Islets. PLoS ONE, 9(7), e102521.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!