A two-step real-time quantitative RT-PCR was used to examine specific mRNA levels. Cells were lysed for quantitative reverse transcription-PCR (qRT-PCR), and total RNA was extracted according to the manufacturer’s instructions (Easy-do Bio, Zhejiang, China). Reverse transcription was carried out with HiScript Q Select RT SuperMix for qPCR (+gDNA wiper; Vazyme, Nanjing, China). To detect the viral NP mRNA, we used oligo(dT) primer for the reverse transcription. And to detect the viral NP cRNA and vRNA, we used primer specifically targeting IAV H9N2 JSC1 cRNA and vRNA for reverse transcription. Quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), and run on an Mx3005P quantitative PCR system(Agilent, California, US). The primers of RT-PCR were designed using PrimerQuest Tool. The sequences of primers for qRT-PCR are listed in Table 3 . Each gene was amplified in triplicate, and the mean threshold (Ct) values were calculated. GAPDH was used for normalization in gene expression analysis. Relative fold changes in gene expression among groups were determined using the 2−ΔΔCt method.
Mx3005p quantitative pcr system
Manufactured by Agilent Technologies
Sourced in China, United States
The Mx3005P quantitative PCR system is a real-time PCR instrument designed for quantitative gene expression analysis. It features a high-performance optical system, precise temperature control, and software for data analysis.
Automatically generated - may contain errors
Lab products found in correlation
Hiscript q select rt supermix for qpcr gdna wiper, by Vazyme (1 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Sybr green kit, by Roche (1 mentions)
Mxpro qpcr software, by Agilent Technologies (1 mentions)
Brilliant 2 sybr green qpcr master mix, by Agilent Technologies (1 mentions)
3 protocols using mx3005p quantitative pcr system
1
Quantitative RT-PCR Analysis of Viral RNA
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from whole cells with TRIzol reagent, and cDNA was then synthesized by using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). qPCR was carried out using a SYBR Green kit (Roche, Germany), and results were detected by using the Mx3005P quantitative PCR system (Agilent Technologies, USA). The primers used are listed in Table 1 .
The primers used for quantitative real-time PCR.
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| NRF2 | ACACGGTCCACAGCTCATC | TGTCAATCAAATCCATGTCCTG |
| p21 | CTGCCCAAGCTCTACCTTCC | CAGGTCCACATGGTCTTCCT |
| STAT3 | TGACATTCCCAAGGAGGAGGC | TGCAGCTTCCGTTCTCAGCTCC |
| ATF4 | AGATGACCTGGAAACCATGC | AGGGATCATGGCAACGTAAG |
| GAPDH | GCGACACCCACTCCTCCACCTTT | TGCTGTAGCCAAATTCGTTGTCATA |
3
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real time PCR was performed using a Mx3005P quantitative PCR system (Agilent Technologies) with Brilliant II SYBR® Green QPCR Master Mix (Agilent Cat # 600828).
The reaction mix (25 µl) contained 12.5 µl of 2X Brilliant II SYBR Green QPCR master mix, 0.4 µl forward primer (20 µM), 0.4 µl of reverse primer (20 µM), 1 µl of 1:10 diluted cDNA template and 10.7 µl nuclease free water. The PCR protocol consisted of 40 amplification cycles with initial denaturation at 95 ο C for 10 min. Each cycle consists of denaturation at D r a f t 8 95 ο C for 30 sec, annealing at 63 ο C for 30 sec, and extension at 72 ο C for 30 sec. Dissociation curves generated by incubating the products for 1 min at 95°C, followed by 30 sec at 55°C and finally 30 sec at 95°C. Data were analyzed using the MXpro QPCR software (Agilent Technologies) to estimate cycle threshold (C T ) values and dissociation curves to estimate the optimal melting temperatures for all reactions. In all experiments, we included two additional negative controls: 1) RT-control, which consisted of a PCR reaction lacking reverse transcriptase, and 2) a no template control (NTC), which used water in place of the cDNA template.
The reaction mix (25 µl) contained 12.5 µl of 2X Brilliant II SYBR Green QPCR master mix, 0.4 µl forward primer (20 µM), 0.4 µl of reverse primer (20 µM), 1 µl of 1:10 diluted cDNA template and 10.7 µl nuclease free water. The PCR protocol consisted of 40 amplification cycles with initial denaturation at 95 ο C for 10 min. Each cycle consists of denaturation at D r a f t 8 95 ο C for 30 sec, annealing at 63 ο C for 30 sec, and extension at 72 ο C for 30 sec. Dissociation curves generated by incubating the products for 1 min at 95°C, followed by 30 sec at 55°C and finally 30 sec at 95°C. Data were analyzed using the MXpro QPCR software (Agilent Technologies) to estimate cycle threshold (C T ) values and dissociation curves to estimate the optimal melting temperatures for all reactions. In all experiments, we included two additional negative controls: 1) RT-control, which consisted of a PCR reaction lacking reverse transcriptase, and 2) a no template control (NTC), which used water in place of the cDNA template.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!