Mx3005p quantitative pcr system
The Mx3005P quantitative PCR system is a real-time PCR instrument designed for quantitative gene expression analysis. It features a high-performance optical system, precise temperature control, and software for data analysis.
Lab products found in correlation
3 protocols using mx3005p quantitative pcr system
Quantitative RT-PCR Analysis of Viral RNA
Quantitative Real-Time PCR Analysis
The primers used for quantitative real-time PCR.
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
NRF2 | ACACGGTCCACAGCTCATC | TGTCAATCAAATCCATGTCCTG |
p21 | CTGCCCAAGCTCTACCTTCC | CAGGTCCACATGGTCTTCCT |
STAT3 | TGACATTCCCAAGGAGGAGGC | TGCAGCTTCCGTTCTCAGCTCC |
ATF4 | AGATGACCTGGAAACCATGC | AGGGATCATGGCAACGTAAG |
GAPDH | GCGACACCCACTCCTCCACCTTT | TGCTGTAGCCAAATTCGTTGTCATA |
Quantitative Real-Time PCR Protocol
The reaction mix (25 µl) contained 12.5 µl of 2X Brilliant II SYBR Green QPCR master mix, 0.4 µl forward primer (20 µM), 0.4 µl of reverse primer (20 µM), 1 µl of 1:10 diluted cDNA template and 10.7 µl nuclease free water. The PCR protocol consisted of 40 amplification cycles with initial denaturation at 95 ο C for 10 min. Each cycle consists of denaturation at D r a f t 8 95 ο C for 30 sec, annealing at 63 ο C for 30 sec, and extension at 72 ο C for 30 sec. Dissociation curves generated by incubating the products for 1 min at 95°C, followed by 30 sec at 55°C and finally 30 sec at 95°C. Data were analyzed using the MXpro QPCR software (Agilent Technologies) to estimate cycle threshold (C T ) values and dissociation curves to estimate the optimal melting temperatures for all reactions. In all experiments, we included two additional negative controls: 1) RT-control, which consisted of a PCR reaction lacking reverse transcriptase, and 2) a no template control (NTC), which used water in place of the cDNA template.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!