Snail sirna

We used an established mouse model that utilized warm hepatic ischemia followed by reperfusion.^{2 (link)} Mice were injected with heparin (100 U/kg), and an atraumatic clip was used to interrupt the arterial/portal venous blood supply to the cephalad liver lobes. After 90 min of ischemia, the clip was removed, and mice were sacrificed after 6 h of reperfusion. Some animals were injected via the tail vein with bone marrow-derived macrophages (BMMs, 5 × 10⁶ cells in PBS/mouse) transfected with lentivirus-expressing HSF1 (Lv-HSF1) 24 h prior to ischemia, and some animals were injected i.v. with Snail siRNA or nonspecific (control) siRNA (2 mg/kg) (Santa Cruz Biotechnology, CA) mixed with mannose-conjugated polymers (Polyplus transfection™, Illkirch, France) at a ratio defined according to the manufacturer’s instructions 4 h prior to ischemia, as described.^{2 (link)} Some animals were injected i.v. with recombinant JAG1 (0.5 mg/kg, R&D Systems) or PBS 1 h prior to ischemia.

The Snail siRNA was purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and ALKBH5 siRNA (CCATGACGTCCCGGGACAACTATAA) was constructed and obtained from Invitrogen. siRNAs (40 nM diluted in 1 mL Opti-MEM) were transfected to SK-OV3 cells using Lipofectamine RNAiMAX (#13778150, Invitrogen). The plasmid of wild-type (pENTER-ALKBH5) and mutated ALKBH5-H204A (pENTER-ALKBH5-H204A) was obtained from WZ Biosciences Inc, while plasmid of wild-type (pSLenti-Snail) and mutated Snail (pSLenti-Snail-mut, adenosine bases in m6A consensus sites replaced by cytosine nucleotides) was constructed and obtained from OBiO Technology. Plasmid (2 µg diluted in 1 mL Opti-MEM) was transfected to SK-OV3 cells using Lipofectamine 3000 Transfection Reagent (#L3000015, Invitrogen). The shRNA of human ALKBH5 was cloned into a lentiviral vector (pLent-3in1-shRNA-CMV-copGFP-P2A-Puro) for knockdown. Sequences of the shRNAs were as followed, stably transfected SK-OV3 cells were selected using puromycin (#ST551, Beyotime, China): siRNA1: GTCCTTCTTTAGCGACTCT; siRNA2: CCATGACGTCCCGGGACAACTATAA; siRNA3: GCTCAGTGGATATGCTGCTGATGAA.