The largest database of trusted experimental protocols

13 protocols using mouse ifn γ

1

Antigen-Specific T Cell Activation by PS-Loaded PLGA Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse T cells were purified from spleens of 2D2 mice, a genetically engineered mouse model with only T cells expressing T cell receptors to MOG, using anti-CD4+ beads (MACS) [45 (link)]. Bone-marrow derived DCs were incubated with PS-loaded PLGA nano-particles (12, 25, or 50 μM PS), PS alone (12, 25, or 50 μM), or blank PLGA nanoparticles at 37 °C for 4 h, and the cells were subsequently washed. For myelin-specific T cell activation, 5 × 104 DCs treated with PS-loaded PLGA nanoparticles, PS alone, or blank PLGA nanoparticles at 37 °C for 4 h were pulsed with MOG35–55 peptide (50 μg/ml) and then incubated with 2 × 105 T cells for 48 h. The cells and media were separated, and the supernatant was probed for mouse IFNγ (Biolegend, 430806), mouse IL-2 (BD, 555148), mouse IL-6 (BD, 555240) mouse TNFα (BD, 555268). T-cells were stained with IL-10 (eBioscience, 12-7101) and FOXP3 (eBioscience, 17-5773-82) to identify the Treg population using flow cytometry.
+ Open protocol
+ Expand
2

Cytokine Scavenging Potential of Microparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse IFN-γ (Biolegend) was incubated with HP MNs, PF-MNs, and PEG MNs at 37 °C at a concentration of 1000 pg/mL in PBS. 100 μL of the supernatant was taken out at intervals of 0, 1, 3, 6, 12, and 24 h, and stored at −20 °C until quantification with the ELISA kit (Biolegend). Moreover, the capability of MNs to scavenge MCP-1, TNF-α, IL-1β, and IL-6 was also investigated by multiplex immunoassay after 24 h.
+ Open protocol
+ Expand
3

Nitrite production in M. abscessus-infected macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bone marrow-derived macrophages were infected with M. abscessus at a MOI 1:10 along with mouse IFN-γ (BioLegend, San Diego, CA, USA) in the absence or presence of 1 mM of NG-nitro-l-arginine methyl ester (l-NAME; Sigma Aldrich, St. Louis, MO, USA) for indicated times. Nitrite formation in culture supernatants was determined via the Griess reaction as described previously (19 (link)).
+ Open protocol
+ Expand
4

AB1 Cell Proliferation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
AB1 cells were cultured in triplicates (5 × 103 cells/well) in 96 well plates. Mouse IFN-γ (Biolegend, San Diego, CA) was added in serial concentrations (0.3, 0.9, 1.2, 5 and 10 U/ml) in 150 μl of medium. After 3 days, cell proliferation assay WST reagent (Roche) was added for 3 h to the culture medium according to the manufacturer’s instructions. The absorbance was measured at 480 nm.
+ Open protocol
+ Expand
5

Serum Cytokine Analysis in Immunized Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
After euthanasia using a CO2 chamber at 3 weeks after immunization, the serum in whole blood by cardiac puncture was collected for mouse IFN-γ (Cat# 430807, BioLegend, San Diego, CA, USA), IL-17 (Cat# 432507, BioLegend), TNF-α (Cat# 430907, BioLegend), and IL-1β (Cat# BMS6002, Invitrogen) analyses. ELISA kits were analyzed from accordance with the directions provided by the manufacturer. The samples were then analyzed with an ELISA microtiter plate auto reader at 450 nm (Molecular Devices, San Jose, CA, USA).
+ Open protocol
+ Expand
6

Measuring IFN-γ Production in Brucella Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Blood samples of five mice from each group were collected 4 and 6 weeks p.i.; IFN-γ was measured using an ELISA kit (Mouse IFN-γ Biolegend-USA). Additionally, 6 weeks p.i., five mice from each group were sacrificed, their spleens were separated aseptically, and their splenocytes were grown and infected by RB51 and the RB51 recombinant containing mLLO-BAX-SMAC to determine IFN-γ production [33 (link)]. B. abortus RB51 and the RB51 recombinant containing mLLO-BAX-SMAC were suspended in PBS, washed thrice, and resuspended in PBS with a concentration of 108 CFU. For heat inactivation, the bacterial suspension was incubated in a 65 °C water bath for 60 min. To confirm complete inactivation, aliquots of the resulting bacterial suspensions were spread onto TSA plates and incubated at 37 °C for five days [34 (link)]. Splenocytes from the inoculated mice were obtained as previously described and grown in 108 heat-inactivated B. abortus RB51 and RB51 recombinant containing mLLO-BAX-SMAC per well in the related groups. The cells were grown for 5 days, and their supernatants were collected. The sera and collected supernatants were tested for IFN-γ, with recombinant Mouse IFN-γ as the standard. The assays were performed in triplicate [30 (link)].
+ Open protocol
+ Expand
7

Murine T Cell Immune Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
Female C57BL/6 (B6) and TCR-δ−/− mice on the B6 background, purchased from Jackson Laboratory (Bar Harbor, ME), were housed and maintained in the animal facilities of the University of California, Los Angeles and were used at 12–16 weeks of age. The experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of California Los Angeles (Protocol number: ARC#2014-029-03A). Recombinant murine IL-12 and IL-23 were purchased from R & D Systems (Minneapolis, MN), fluorescein isothiocyanate (FITC)-, phycoerythrin (PE)-, or allophycocyanin (APC)-conjugated mouse monoclonal antibodies against mouse αβ T cell receptor (TCR, clone H57–597), mouse γδ TCR (clone GL3), mouse IL-17, mouse IFN-γ, mouse MHC class II, or mouse CD25 and isotype control antibodies were purchased from BioLegend (San Diego, CA). ADA was a gift from Sigma-Tau Pharmaceuticals Inc. (Gaithersburg, MD).
+ Open protocol
+ Expand
8

Cytokine Quantification by ELISA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse IFN-γ (cat. 430805), TNF-α (cat. 430905), IL-12 (cat. 433605), IL-4 (cat. 431105), and IL-6 (cat. 431305) ELISA kits were purchased from BioLegend (San Diego, CA, USA), and ELISA was performed according to the manufacturer’s protocols.
+ Open protocol
+ Expand
9

Bone Marrow-Derived Macrophage Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDM were prepared by collecting bone marrow from the femurs of mice and then plating the cells in Petri dishes in DMEM supplemented with 10% heat-inactivated fetal calf serum (FCS: Invitrogen Life Technologies), and 10% macrophage colony-stimulating factor (M-CSF)-conditioned medium. The latter was collected from the L929 cell line. After incubation at 37°C in 5% CO2 for 6 days, FCS-BMDM were harvested and added to 6-, 24-, or 96-well plates at the indicated density, and incubated overnight before infection. When applicable, BMDM were treated with 100 units/ml of mouse IFN-γ (#575306; Biolegend, San Diego, CA).
+ Open protocol
+ Expand
10

CRISPR-Cas9 Mediated Gene Editing in Murine Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CRISPR-Cas9–mediated genome editing was carried out as described (24 –26 (link)), with the use of murine IRF1 target sequence GAAGCACGCTGCTAAGCACGG. Briefly, plasmid encoding gRNA, Cas9-mCherry was transfected into MC38, CT26 and B16-F10 parental cell lines with lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA). After 48 h of transient transfection, mCherry+ single cells were sorted into 96-well cell culture plates. Single cell clones were expanded and transferred into 12-well cell culture plate. Cells were treated with 100 ng/mL mouse IFNγ (Biolegend, San Diego, CA) for 6 h before harvesting. We examined the expression of IRF1 via western blot.
Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific). B16-F10 IRF1-KO cells were transduced with lentivirus prepared from pInducer20-PD-L1 and selected by G418 (800 μg/mL) to make a stable cell line. Doxycycline (DOX) induced expression of PD-L1 in B16-F10 IRF1-KO cells was confirmed by western blot.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!