Ticks used for PCR were washed as described above, placed individually in sterile 1.5 ml micro-centrifuge tubes and sliced into 2–3 pieces using sterile 25G x 5/8 inch needles (BD, Franklin, NJ, USA) and fine forceps. To avoid carry-over of DNA, fresh needles and forceps were used for individual ticks. Pieces were then submerged in 300 μl Cell Lysis Solution (Puregene Core Kit A; Qiagen Sciences, Valencia, CA, USA), vortexed, heated to 75°C for 5 min and allowed to further dissolve overnight at room temperature. DNA was extracted from ticks using the Puregene Core Kit A per manufacturer’s instructions (Qiagen) and PCR was performed using PER 1 (5'TTTATCGCTATTAGATGAGCCTATG3') and PER 2 (5'CTCTACACTAGGAATTCCGCTAT3') primers [35 (link)] with GoTaq DNA polymerase (Promega, Madison, WI, USA) to amplify ehrlichial DNA. These primers target the 16S rDNA and produce a 451 bp product that was visualized after agarose gel electrophoresis and GelGreen staining (Biotium, Hayward, CA, USA) to verify successful PCR-amplification. The primer set can be used to identify members of the genera Anaplasma and Ehrlichia (including EML), but not does not amplify sequence of the I. scapularis symbiont, Rickettsia buchneri [36 (link)].
Puregene core kit a
Manufactured by Qiagen
Sourced in United States, Germany, Japan
The Puregene Core Kit A is a DNA extraction kit designed for the purification of genomic DNA from a variety of sample types, including whole blood, tissue, and cultured cells. The kit utilizes a rapid and efficient lysis and precipitation protocol to isolate high-quality genomic DNA suitable for downstream molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Dneasy blood and tissue kit, by Qiagen (3 mentions)
Hiseq 2000, by Illumina (3 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
Dna clean and concentrator 5 kit, by Zymo Research (2 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Qiaamp circulating nucleic acid kit, by Qiagen (2 mentions)
Rnalater, by Thermo Fisher Scientific (2 mentions)
Rnaqueous 4pcr kit, by Thermo Fisher Scientific (2 mentions)
Methocult m3434 methylcellulose medium, by STEMCELL (2 mentions)
Superscript 2 reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions)
Picogreen assay for dsdna, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (2 mentions)
Hiseq 2500 sequencer, by Illumina (2 mentions)
Kapa library preparation kit, by Roche (2 mentions)
Novaseq 6000, by Illumina (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
C1000 touch thermal cycler, by Bio-Rad (2 mentions)
Dnase, by Avantor (2 mentions)
Quantifiler human dna quantification kit, by Thermo Fisher Scientific (2 mentions)
85 protocols using puregene core kit a
1
Tick DNA Extraction and PCR Amplification
2
Extraction and Purification of Genomic and Cell-free DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from cell lines or xenograft tumors using the QIAamp DNA Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Conditioned medium (2 ml) was collected, centrifuged at 2000 × g for 5 min and the supernatant stored at –80°C. Thawed conditioned media and plasma samples were centrifuged at 2000 × g for 5 min to clear debris, then supernatant was centrifuged at 20,000 × g for 5 min. Cell-free DNA was purified from processed conditioned media, 200 µl stored human patient plasma, 1000 µl stored healthy individual plasma and 600 µl mouse plasma using the QIAamp Circulating Nucleic Acid kit (Qiagen) then concentrated to 50 µl using the DNA Clean and Concentrator-5 kit (Zymo Research, Freiburg, Germany), both according to manufacturers’ directions. Neuroblastoma gDNA was extracted using the Qiagen Puregene Core kit A (Qiagen) according to the manufacturer’s instructions. Extracted DNA samples were quantified on a Qubit 2.0 fluorometer (Life technologies, Darmstadt, Germany). Purified genomic and cell-free DNA were stored at –80°C until MYCN and ALK copy number detection.
3
Isolation and Quantification of Circulating Cell-Free DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from tumor tissue using the Qiagen Puregene Core kit A (Qiagen) or the QIAamp DNA Mini kit (Qiagen) according to the manufacturer’s instructions and quantified on a Qubit 2.0 fluorometer (Life Technologies). Fragmentation of genomic DNA was achieved by 5 U of AluI or HaeIII restriction enzyme (New England Biolabs) added to each droplet digital PCR (ddPCR) reaction [14 (link)]. Thawed blood and bone marrow plasma, CSF, and urine samples were centrifuged at 2000× g for 5 min to clear debris, then supernatants were centrifuged at 20,000× g for 5 min. Cell-free DNA was purified from a minimum of 40 µL stored samples using the QIAamp Circulating Nucleic Acid kit (Qiagen), then concentrated to 50 μL using the DNA Clean and Concentrator-5 kit (Zymo Research), both according to manufacturers’ directions. Total cfDNA was quantified using the cfDNA ScreenTape assay (Agilent) and Agilent 4200 TapeStation System according to the manufacturer’s instructions [17 (link)]. DNA size distribution was likewise assessed with the Agilent 4200 TapeStation System [17 (link)]. DNA fragments between 100 and 300 bp were considered to be total cfDNA [39 (link)]. Assessment of DNA size distribution and cfDNA quantity does not allow any conclusion to be drawn about the cell(s) of origin.
4
Genomic and Transcriptomic Analysis of Aedes aegypti
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All sampled mosquitoes consisted of 2- to 4-d-old non-blood-fed Ae. aegypti females grown in standardized laboratory conditions. For each population/phenotype, 200 individuals were collected and stored individually in silica gel. For each population, three pools of 30 females not exposed to insecticide were also collected and stored in RNAlater (Life Technologies) for gene expression analyses. Gene amplification screening by exon capture and mass sequencing was performed on gDNA extracted from two pools of 65 individuals per population/phenotype. Genomic DNA was extracted using the PureGene Core Kit A (Qiagen) following the manufacturer's instructions. For each population/phenotype, gDNA from each pool were then combined in equal quantity in order to be representative of a total of 130 individuals. Quantitative PCR validation of gene amplifications and genotyping of kdr mutations was performed on gDNA extracted from 12 single adult females per population/phenotype using the method described in Collins et al. (1987) (link) and resuspended in 20 µL nuclease-free water. Gene expression analyses were performed on RNA extracted from three pools of 30 adult females per population (R and S populations) using the RNAqueous4PCR kit (Life Technologies) according to the manufacturer's instructions and resuspended in 50 µL nuclease-free water.
5
Genome-wide mutagenesis screen in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lines that acquired recessive lethal mutations were maintained for at least three generations. Worms were rinsed off with deionized water and concentrated. Genomic DNA was purified using Puregene Core Kit A (QIAGEN, Valencia, CA). DNA sequencing was performed at the Novogene Bioinformatics Institute (Beijing, China). Sequence reads were mapped to the C. elegans reference genome version WS230 (http://www.wormbase.org ) using the short-read aligner BWA (Li and Durbin 2010 (link)), which resulted in an average sequencing depth for each sample ranging from 22× to 57× with a median of 34×. Single-nucleotide variations (SNVs) and small insertions/deletions were identified and filtered with the help of the SAMtools toolbox (Li et al. 2009 (link)). Candidate variants at genomic locations for which the parental N2 strain had an agreement rate with the reference genome < 95% were eliminated from further consideration. Each variant was annotated with a custom Perl script and gene information downloaded from WormBase version WS230. Copy numbers were estimated from the alignments with a procedure analogous to that of Itani et al. (2016 (link)) using 5-kb wide overlapping sliding windows with the alignments from the parental strain used as the reference.
6
RNA Extraction from Tumor Samples
7
Quantitative Detection of P. gingivalis in CSF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 50 μl of CSF using Puregene Core Kit A (Qiagen). The final DNA pellet was dissolved in 50 μl of DNA hydration buffer. A preamplification PCR assay (20 cycles) was performed with 5 μl of CSF DNA and P. gingivalis hmuY gene–specific H1.2 primers [GGTGAAGTCGTAAATGTTAC (H1.2 forward) and TTGACTGTAATACGGCCGAG (H1.2 reverse)]. A serial dilution of synthetic template DNA was also preamplified for the calculation of copy number. The preamplified PCR products were diluted, and a qPCR assay was performed with nested hmuY primers [GAACGATTTGAACTGGGACA (H1.1 forward) and AACGGTAGTAGCCTGATCCA (H1.1 reverse)] and a probe (/56-FAM/TTCTGTCTT/ZEN/GCCGGAGAATACGGC/3IABkFQ/). A serial dilution of the same synthetic template DNA was included in the qPCR assay to generate a standard curve and calculate starting copy number in CSF.
8
Saliva DNA Extraction and qPCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 50 μl of saliva using Puregene Core Kit A (Qiagen). The final DNA pellet was dissolved in 50 μl of DNA hydration buffer. A qPCR assay was performed with 2 μl of saliva DNA and hmuY primers (H1.1) and the probe mentioned above. A serial dilution of synthetic template DNA was included in the qPCR assay to calculate starting copy number.
9
DNA Sequencing of Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA sequencing of specific genes or regulatory regions was performed as previously described (28 (link)). Briefly, genomic DNA from selected strains was isolated using PureGene core kit A (Qiagen, Valencia, CA). The target genes were PCR amplified in separate PCRs using platinum Taq DNA polymerase High Fidelity (Life Technologies, Inc. Corporation, Carlsbad, CA) and specifically designed primer sets (see Table S4 for the primers used in this study and Text S1 in the supplemental material for details). PCR replicates were pooled and sequenced at the Colorado State University proteomic and metabolomics core facility or the University of Florida Interdisciplinary Center for Biotechnology Research. Alignment of the sequencing reads and subsequent comparisons were performed using Sequencher version 5.1 (Gene Codes Corporation, Ann Arbor, MI).
10
Isolation and Genomic Analysis of Pre-Malignant LSK Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!