Cells were diluted to 1 × 106 cells/ml with FACS buffer (2% FBS, 10 mM HEPES, and 10 mM NaN3 at a pH of 7.2, all from ThermoFisher Scientific) and incubated with the primary antibodies for 30 min at 4 °C. The following antibodies were used: CD44-FITC (0.25 µg/106 cells, 11-0441-81, Thermo Fisher), CD140a-PE (10 µl/106 cells, 558002, BDBioscience, Eysins, Switzerland), and CD140b-APC (5 µl/106 cells, A15719, Thermo Fisher). Right before analysis, the cells were stained with SYTOXTM green dead cell stain (1 µl/ ml) to assess viability. UltraComp eBeadsTM compensation beads (Thermo Fisher) were used for compensation. The analysis was performed on a BD FACSCantoTM II HTS (BD Biosciences).
Facscanto 2 hts
Manufactured by BD
Sourced in United States
The BD FACSCanto II HTS is a flow cytometry system designed for high-throughput sample analysis. It features automated sample handling capabilities and is capable of multi-color analysis of cellular samples.
Automatically generated - may contain errors
Lab products found in correlation
Ultracomp ebeads compensation beads, by Thermo Fisher Scientific (3 mentions)
Facs buffer, by Thermo Fisher Scientific (2 mentions)
Cd140b apc, by Thermo Fisher Scientific (2 mentions)
Cd140a pe, by BD (2 mentions)
Cd44 fitc, by Thermo Fisher Scientific (2 mentions)
Intracellular fixation buffer, by Thermo Fisher Scientific (2 mentions)
Brilliant violet 421, by BioLegend (2 mentions)
Gblock, by Integrated DNA Technologies (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Facsdiva, by BD (1 mentions)
Red blood cell lysis buffer, by Merck Group (1 mentions)
Live dead fixable violet dead cell stain, by Thermo Fisher Scientific (1 mentions)
Sybr green 1 nucleic acid stain, by Thermo Fisher Scientific (1 mentions)
Matlab, by MathWorks (1 mentions)
Facsmelody, by BD (1 mentions)
Facsaria 3, by BD (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Luciferase assay substrate, by Promega (1 mentions)
Passive lysis buffer (plb), by Promega (1 mentions)
Fluostar omega, by BMG Labtech (1 mentions)
18 protocols using facscanto 2 hts
1
Multiparametric Flow Cytometry Analysis
2
Multiparametric Flow Cytometry Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were diluted to 1 x 10 6 cells/ml with FACS buffer (2 % FBS, 10 mM HEPES and 10 mM NaN3 at a pH of 7.2, all from ThermoFisher Scientific) and incubated with the primary antibodies for 30 minutes at 4°C. The following antibodies were used: CD44-FITC (0.25 µg/10 6 cells, 11-0441-81, Thermo Fisher), CD140a-PE (10 µl/10 6 cells, 558002, BDBioscience, Eysins, Switzerland) and CD140b-APC (5 µl/10 6 cells, A15719, Thermo Fisher). Right before analysis, the cells were stained with SYTOX TM green dead cell stain (1µl/ ml) to assess viability. UltraComp eBeads TM compensation beads (Thermo Fisher) were used for compensation. The analysis was performed on a BD FACSCanto TM II HTS (BD Biosciences).
3
Flow Cytometric Analysis of Activated pMET
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sorted GFP+ cells were washed with Ham’s F12 media, centrifuged at 800 × g for 5 min at 4°C and aspirated supernatant. Cells were fixed with 1.5% PFA for 15 min at RT, washed with PBS, centrifuged at 800 × g for 5 min at 4°C, and supernatant was aspirated. The cell pellet was resuspended in 100% methanol cooled to –20°C, vortexed for 30 s, and incubated on ice for 30 min. Cells were washed with 0.5% BSA in PBS with sodium azide for 5 min, centrifuged at 800 × g for 5 min at 4°C, aspirated supernatant. Cells were washed with 0.5% BSA with sodium azide for 5 min, centrifuged at 800 × g for 5 min at 4°C, aspirated supernatant, and resuspended into 0.5% BSA with sodium azide. pMET conjugated to phycoerythrin (PE) (Cell Signaling, 12468) primary antibody 1:50 dilution was added to the samples for 20 min at RT. Samples were washed with PBS, centrifuged at 800 × g for 5 min at 4°C, aspirated supernatant, and resuspended in PBS for analysis on BD FACSCanto II HTS (BD Biosciences). Median PE frequency from FloJo was used for statistical analysis.
4
Inducible shRNA Screening via Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tet-pLKO-puro was a gift from Dmitri Wiederschain (Addgene plasmid # 21915). We exchanged the sequence of IRES-PuroR in the plasmid with that of P2A-EGFP using gBlocks® from Integrated DNA Technologies. Each shRNA was cloned into the Tet-pLKO-EGFP vector according to the protocol provided on the webpage (https://media.addgene.org/data/plasmids/21/21915/21915-attachment_Jws3xzJOO5Cu.pdf ). We induced each plasmid into the target cells by lentivirus. psPAX2 and pCMV-VSV-G were used for lentiviral transduction. psPAX2 and pCMV-VSV-G were gifts from Didier Trono and Bob Weinberg (Addgene plasmids # 12260 and # 8454, respectively). Four days after the transduction, shRNA was induced by administration of doxycycline (final 1 μg permL, Clontech, Cat no. 631311). Fractions of GFP were measured over time by flow cytometry (BD FACSCanto II HTS, BD Biosciences).
The sequences used for shRNAs are:
shCtrl; CTCTCAACCCTTTAAATCTGA
shIRF4-1; CCGCCATTCCTCTATTCAAGA
shIRF4-2; GTGCCATTTCTCAGGGAAGTA
shMDM2; GATTCCAGAGAGTCATGTGTT (TRCN0000003377)
shMDM4; CACCTAGAAGTAATGGCTCAA (TRCN0000003857)
The sequences used for shRNAs are:
shCtrl; CTCTCAACCCTTTAAATCTGA
shIRF4-1; CCGCCATTCCTCTATTCAAGA
shIRF4-2; GTGCCATTTCTCAGGGAAGTA
shMDM2; GATTCCAGAGAGTCATGTGTT (TRCN0000003377)
shMDM4; CACCTAGAAGTAATGGCTCAA (TRCN0000003857)
5
Multiplex Flow Cytometry of Mesenchymal Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The same number of cells was seeded into flat-bottom T75 cell culture flasks (Sigma-Aldrich #CLS3290) coated with 0.1 percent Collagen (Sigma-Aldrich #C9791), cultured to confluence in high glucose DMEM medium (Gibco #61965026) supplemented with 20 percent FBS (Gibco #10082147), 10 percent HS (Gibco #26050088) and 1 percent penicillin–streptomycin (Gibco #15140122). The single-cell suspension was diluted to 1 × 106 cells/mL with FACS buffer (2 percent foetal bovine serum (FBS, Gibco #10082147), 10mM HEPES and 10mM NaN3 at a pH of 7.2) and supplemented for 30 min at 4 °C protected from light with the following antibodies: anti-mouse CCR1-APC (R&D systems #FAB5986A), anti-mouse CCR5-PE (Invitrogen #12-1951-82), anti-mouse PDGFRA-APC (Invitrogen #17-1401-81) and anti-mouse PDGFRB-APC (Invitrogen #17-1402-82), anti-mouse CD34-eFluor450 (Invitrogen #48-0341-82), anti-mouse CD44 (Invitrogen #17-0441-82). All antibodies were titrated (Table S1 ). Analysis was performed on a BD FACSCanto II HTS (BD biosciences) equipped with three lasers. Data were collected with the FacsDIVA (BD biosciences) software. Biexponential analysis was performed using FlowJo (Treestar) software. The mouse sorting experiments were performed once (Figure 3 D,E, Figure 4 B,C).
6
Multicolor Flow Cytometry Phenotyping
7
Quantifying Antibody-Antigen Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-cell clones of NIH3T3 cells were blocked in PBS containing 1% goat serum and incubated with titrated anti-OVA mIgG2a, anti-OVAmIgG1 or mIgG2a isotype antibodies for 30 min at 4°C. Cells were washed three times with PBS containing 1% BSA and incubated with Alexa Fluor 647 anti-mIgG (115-605-062; Jackson ImmunoResearch) and LIVE/DEAD Fixable Violet Dead Cell Stain (L34964; Thermo Fisher Scientific). The cells were washed twice and FACS data were collected via the BD FACSCanto II HTS. The A647 Geo means gated live singlets were used to generate the graphs. FlowJo and GraphPad Prism were used for data analysis.
8
Quantifying Algal and Bacterial Cells via Flow Cytometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluorescent counting beads for flow cytometry (AlignflowTM, Thermofisher) were diluted 20 times with PBS and 50 µl was added to each well of the 96-well plate for calibration. SYBR Green I nucleic acid stain (Thermofisher) was added to the samples with a final concentration of 0.1% v/v, and allowed to sit at room temperature at least for 30 min without light exposure.
Flow cytometry analysis was conducted on a BD FACS Canto II HTS to quantify the number of algal and bacterial cells with parameter setting as follows: (voltage) FSC = 580, SSC = 370, GFP = 400, PE = 330, PerCP = 647, PE-Cy7 = 677, Alexa Fluor 680 = 290, APC-Cy7 = 410, Pacific Blue = 440, AmCyan = 539. Populations were plotted with GFP-A and APC-Cy7-A intensities, allowing a clear distinction between counting beads, stained algal, and bacterial cells. The data were exported to.csv files using FlowJo (BD) and converted into cell density data using MATLAB (Mathworks).
Flow cytometry analysis was conducted on a BD FACS Canto II HTS to quantify the number of algal and bacterial cells with parameter setting as follows: (voltage) FSC = 580, SSC = 370, GFP = 400, PE = 330, PerCP = 647, PE-Cy7 = 677, Alexa Fluor 680 = 290, APC-Cy7 = 410, Pacific Blue = 440, AmCyan = 539. Populations were plotted with GFP-A and APC-Cy7-A intensities, allowing a clear distinction between counting beads, stained algal, and bacterial cells. The data were exported to.csv files using FlowJo (BD) and converted into cell density data using MATLAB (Mathworks).
9
Immunophenotyping and Sorting of Muscle Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The single-cell suspension was diluted to 1 3 10 6 cells/ml with FACS buffer (2% FBS, 10 mM HEPES and 10 mM NaN 3 at a pH of 7.2). Cells were incubated with the primary antibodies 30 min at 4 C protected from light. The following antibodies were used: TER-119-FITC (0.5 mg/10 6 cells), CD31-FITC (0.25 mg/10 6 cells) and CD45-FITC (0.25 mg/10 6 cells) for selecting the LIN -population; SCA-1-SB436 (0.5 mg/10 6 cells) and/or CD140a-APC (1 ml/10 6 cells) to enrich for ISCs, ALPL-PE (0.25 mg/10 6 cells) to enrich the LIN - population for MABs, Itga7-PE-Vio770 (0.15ng/10 6 cells) and CD34-eFluor660 (2.5 mg/10 6 cells) to enrich for MuSCs; CD55-PE (0.5 mg/10 6 cells) and CD142-PE (2 ml/10 6 cells) to separate the ISC populations. The cells were washed twice and stained with SYTOX green dead cell stain (1ml/ ml) to assess viability. The analysis was performed on a BD FACSCanto II HTS (BD Biosciences). Sorting was performed on the BD FACSAria III (BD Biosciences), using a 100 mm nozzle at 18 PSI or on the BD FACSMelody (BD Biosciences), using a 100 mm nozzle at 22 PSI (n = 3-4). Compensation measurements were performed for single cell stains with UltraComp eBeads compensation beads (Invitrogen #01-2222-41). Data were collected with the FacsDIVA software and analysis was performed using FlowJo software.
10
GAP-GFP Fusion Protein Expression in SW620 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pE-Growth-associated protein (GAP) (1-20 a.a., MLCCMRRTKQVEKNDEDQKI)-GFP plasmid was transfected using LipofectamineTM 2000 (Invitrogen) into SW620 cells that were seeded to 70% confluency in 6-well plate. Briefly, 10 µg of plasmid was mixed with 10 µl of LipofectamineTM 2000 in 500 µl RPMI medium at room temperature for 20 min. Cells were washed and overlaid with 1.5 mL RPMI (10% FBS). Plasmid-LipofectamineTM mixture was then overlaid onto the cells. Cells were incubated at 37 °C with 10% CO2. Cells with stable expression of GAP-GFP fusion proteins were selected following multiple rounds of single cell cloning into wells of 96-well plate. Expression of the GAP-GFP fusion protein in the expanded colonies was monitored using a Zeiss AxioObserver Z1 microscope and analysed by BD FACSCanto II HTS (BD Biosciences) using FlowJo software (TreeStar).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!