Lc480 light cycler

Manufactured by Roche

Sourced in Germany, Switzerland, France, Australia

The LC480 Light Cycler is a real-time PCR instrument manufactured by Roche. It is designed to perform quantitative and qualitative nucleic acid analysis. The device utilizes fluorescence detection to monitor the amplification of target DNA or RNA sequences in real-time during the PCR process. The core function of the LC480 Light Cycler is to provide accurate and reliable data for gene expression analysis, genotyping, and other molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (8 mentions) Rneasy mini kit, by Qiagen (6 mentions) Trizol reagent, by Thermo Fisher Scientific (4 mentions) Sybr green, by Roche (4 mentions) Rneasy kit, by Qiagen (3 mentions) Sybr select master mix, by Thermo Fisher Scientific (3 mentions) Iscript cdna synthesis kit, by Bio-Rad (3 mentions) Sybr green master mix, by Roche (2 mentions) Tissuelyser 2, by Qiagen (2 mentions) Peqgold total rna kit, by Avantor (2 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Qiazol, by Qiagen (2 mentions) Hiscript q rt supermix for qpcr, by Vazyme (2 mentions) Superscript 2, by Thermo Fisher Scientific (2 mentions) Rneasy plus mini kit, by Qiagen (2 mentions) Quick rna miniprep kit, by Zymo Research (2 mentions) Spectrum rna plant extraction kits, by Merck Group (2 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions) Lightcycler 480 sybr green 1 master mix, by Roche (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

LC480 (158 citations) Light Cycler LC480 system (16 citations) LC480 cycler (14 citations) Light-Cycler LC480 real-time PCR system (3 citations) LC480 Light Cycler II (2 citations) Light Cycler LC480 device (2 citations) Light Cycler 480 (LC480) system (2 citations) Syber green on LC480 light cycler (2 citations)

79 protocols using lc480 light cycler

Quantitative gene and miRNA analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was carried out using Trizol (Life Technologies) according to manufacturer's instructions. For gene analysis, 1 μg RNA was used for first strand cDNA synthesis using random primers with transcriptor high-fidelity cDNA synthesis kit (Roche, Sussex, UK) according to manufacturer's instructions. For quantitative real-time PCR (qRT-PCR), amplification of PCR products was quantified using FastStart SYBR Green Master (Roche) on a Roche LC480 Lightcycler, using primer sets for SMAD4 (Forward 5'-AAGGTTCCTTCAAGCTG CCC-3′; Reverse 5'-CAATGGCTTCTGTCCTGTGGA-3′), VEGFα (Forward 5'-AGCTACTGCCATCCAATCGA-3′; Reverse 5'-GGTGAGGTTTGATCCG CATA-3′), and housekeeping gene β-actin (Forward 5'-GGACTTCGAGC AAGAGATGG-3′; Reverse 5'-AGCACTGTGTTGGCGTACAG-3′). Expression was normalized to β-actin and graphs represent the combined results of three independent biological replicates.
For microRNA analysis, qRT-PCR for miR-199a-5p was performed using the miRCURY LNA™ microRNA PCR system (Exiqon, Vedbaek, Denmark). 20 ng template RNA was used in each first strand cDNA synthesis reaction. PCR was performed over 40 amplification cycles and fluorescence monitored on the Roche LC480 Lightcycler. For all qRT-PCR miRNA analysis, normalization was against U6snRNA and graphs represent the combined results from 3 independent biological replicates, unless otherwise indicated.

Lynch S.M., Ward M., McNulty H., Angel C.Z., Horigan G., Strain J.J., Purvis J., Tackett M, & McKenna D.J. (2020). Serum levels of miR-199a-5p correlates with blood pressure in premature cardiovascular disease patients homozygous for the MTHFR 677C > T polymorphism. Genomics, 112(1).

+ Open protocol

+ Expand

Profiling Astroglial Transcripts in Hippocampus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Astroglial polysomal RNAs were extracted from postnatal days 10 to 50 Aldh1l1:L10a-eGFP mice hippocampi by using the Translating Ribosome Affinity Purification (TRAP; [40 (link)]) followed by extraction with RNeasy Lipid tissue kit (Qiagen, USA). cDNAs were synthetised from 1 μg RNA using Reverse Transcriptase Superscript III (Thermo Fisher, USA) and stored at −80°C. PCR was performed in triplicate on a LC480 Roche Light cycler on 1 μl cDNA using SybrGreen master mix (Roche, Switzerland). The cycle used was 50°C for 2 min, 95°C for 5 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. The relative abundance of amplified cDNA was calculated as 2^−ΔCt, where ΔCt (change in cycle threshold) equals Ct in P30 and P50 samples minus Ct in P10 samples. Results are expressed as means of 2^−ΔCt tested cDNA/ 2^−ΔCt RNA18s values. Experiments were done on three independent pools of hippocampi of three mice each. The following primers were used: Px1 forward 5′-CCTGCAGAGCGAGTCTGGAA-3′; Px1 reverse 5′-TGCGGGCAGGTACAGGAGTA-3′; RNA18s forward 5′-TTGAAAATCCGGGGGAGAG-3′; RNA 18s reverse 5′-ACATTGTTCCAACATGCCAG-3′.

Vasile F., Dossi E., Moulard J., Ezan P., Lecoin L., Cohen-Salmon M., Mailly P., Le Bert M., Couillin I., Bemelmans A, & Rouach N. (2022). Pannexin 1 activity in astroglia sets hippocampal neuronal network patterns. PLOS Biology, 20(12), e3001891.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated using the TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, MA) and used for the synthesis of cDNA as described previously [58 (link)]. For relative quantification of the mRNA levels, PCR analyses were performed with a LC480 Roche LightCycler (Roche Diagnostics Deutschland GmbH, Mannheim, Germany) with a Takara SYBR Premix ExTaq system (Takara Bio Inc., Kusatsu, Japan). Primers were synthesized by Bioneer (Daejeon, Republic of Korea) and the primer sequences for the human genes are: NRF2, 5′-ATAGCTGAGCCCAGTATC-3′ and 5′-CATGCACGTGAGTGCTCT-3′; AKR1C1, 5′-CGAGAAGAACCATGGGTGGA-3′ and 5′-GGCCACAAA-GGACTGGGTCC-3′; NQO1, 5′- CAGTGGTTTGGAGTCCCTGCC-3′ and 5′-TCCCCGTGGATCCCTTGCAG-3′; c-MET, 5’-TATGTGGCTGGGACTTTGGA-3’ and 5’-GCTTATTCATGGCAGGACCAAC-3’; EGFR, 5’- CGAATGGGCCTAAGATCCCG -3’ and 5’-AGCTTGGTTGGGAGCTTCTC-3’; BCRP/ABCG2, 5’-CACAACCATTGCATCTTGGCTG-3’ and 5’-TGAGAGATCGATGCCCTGCTTT-3’; HDAC1, 5′-TGCTAAAGTATCACCAGAGGGT-3′ and 5′-TGGCCTCATAGGACTCGTCA-3′; HDAC2, 5′-ATGGCGTACAGTCAAGGAGG-3′ and 5′-TCATTTCTTCGGCAGTGGCT-3′; HDAC4, 5′-CCCAGCACGGTGGATGTG-3′ and 5′-GGATCTGCCTCTGGATCTGC-3′; hypoxanthine phosphoribosyltransferase-1 (HPRT1), 5′-TGGCGTCGTGATTAGTGATG-3′ and 5′-GCTACAATGTG-ATGGCCTCC-3′.

Choi B.H., Ryu D.Y., Ryoo I.G, & Kwak M.K. (2017). NFE2L2/NRF2 silencing-inducible miR-206 targets c-MET/EGFR and suppresses BCRP/ABCG2 in cancer cells. Oncotarget, 8(63), 107188-107205.

+ Open protocol

+ Expand

Quantitative PCR of Caenorhabditis elegans

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from an age-synchronized population of ~2000 animals flash frozen in liquid nitrogen on Days 1 or 5 of adulthood. RNA was extracted with TRIzol (Life Technologies) and purified using a Qiagen RNeasy kit with an additional DNA digestion step performed with a Qiagen DNase I kit. M-MuLV reverse transcriptase and random 9-mer primers (New England Biolabs) were used for reverse transcription of 1 μg of RNA per sample [52 (link)]. Quantitative PCR was performed using SYBR Green Master Mix and a Roche LC480 LightCycler. A standard curve was included for each primer using serial dilutions of a mixture of cDNAs, and the observed CT values were converted to relative values according to the standard curve obtained with the relevant primers. Target gene mRNA levels were normalized against the geometric mean mRNA levels of the housekeeping genes ama-1 (large subunit of RNA polymerase II) and nhr-23 (nuclear hormone receptor) [29 (link), 53 (link)]. Primer sequences can be found in S3 Table. Each biological sample was analyzed with three technical replicates. The mean ± SEM for each mRNA was calculated and the data were analyzed by one-way ANOVA using GraphPad Prism.

Gelino S., Chang J.T., Kumsta C., She X., Davis A., Nguyen C., Panowski S, & Hansen M. (2016). Intestinal Autophagy Improves Healthspan and Longevity in C. elegans during Dietary Restriction. PLoS Genetics, 12(7), e1006135.

+ Open protocol

+ Expand

qPCR Analysis of Cancer Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR Assays for EGFR, ERCC1, RRM1 and HIF1 and TBP as a so called housekeeping gene were performed on LC480 light cycler (Roche, Mannheim, Germany), either using a SYBR-Green assay (MesaBlue, Eurogentec, Liège, Belgium), or light cycler FRET probes from Roche’s universal probe library. Primers and probes and cycling parameters are depicted in Table 2. 18S rRNA was used to normalize expression levels. Expression values were expressed as absolute expression levels (copies/18S) for each gene, or as relative expression levels to the average expression measured in the 12-sample set of each patient to make intersample differences easily comparable among different genes, regardless of their absolute expression levels.

Lindner M., Morresi-Hauf A., Stowasser A., Hapfelmeier A., Hatz R.A, & Koch I. (2019). Quality assessment of tissue samples stored in a specialized human lung biobank. PLoS ONE, 14(4), e0203977.

+ Open protocol

+ Expand

Quantification of Gene Expression in Frozen Lung Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fresh lung tissue was snap frozen in liquid nitrogen and kept at −80°C until further processing. Frozen tissue was pulverized using a TissueLyser II (Qiagen). Total RNA from lung tissue homogenate was isolated using QIAzol (Qiagen) and purified with the peqGOLD Total RNA Kit (Peqlab), according to the manufacturer’s instructions. cDNA was synthesized using reverse transcription and M-MLV Reverse Transcriptase (Invitrogen). mRNA expression of target genes was compared with reference control hypoxanthine-guanine phosphoribosyltransferase (Hprt)-1, using SYBR Green (Roche) and a LC480 Light Cycler (Roche). Primers were used at a final concentration of 500 nM with the following sequences: Hprt forward 5′-CCTAA GATGAGCGCAAGTTGAA-3′, reverse 5′-CCACAGGACTAGAACACC TGCTAA-3′; Axin2 forward 5′-AGCAGAGGGACAGGAACCA-3′, reverse 5′-CTGAACCGATTCATGACCAC-3′; Fzd4 forward 5′-TCCAGCCAGCTGCAGTTCTTCC-3′, reverse 5′-CTGAAAGGCACATGCCACCGC-3′; Fgf7 forward 5′-AGGCTCAAGTTGCACGAGGC-3′, reverse 5′-GCGGTTGCTCCTTGACTTTTGTT-3′; Hgf forward 5′-TGCCTGTGCCTTGACTTAGCG-3′, reverse 5′-CCGGGCTGAAAGAATCAAAGCA-3′; Adamts4 forward 5′-AACCAAGCGCTTCGCTTCTCT-3′, reverse 5′-A GCTGCCATAACCGTCAGCA-3′; and Eln forward 5′-GGCGTCTTGCTGATCCTCT-3′, reverse 5′-ATAATAGACTCCACCGGGAACT-3′. Relative transcript expression of a gene was calculated as ΔCt (ΔCt = Ct reference gene – Ct target gene).

Costa R., Wagner D.E., Doryab A., De Santis M.M., Schorpp K., Rothenaigner I., Lehmann M., Baarsma H.A., Liu X., Schmid O., Campillos M., Yildirim A.Ö., Hadian K, & Königshoff M. (2021). A drug screen with approved compounds identifies amlexanox as a novel Wnt/β-catenin activator inducing lung epithelial organoid formation. British journal of pharmacology, 178(19), 4026-4041.

+ Open protocol

+ Expand

Protein Thermal Stability Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

2 μM protein in PBS was mixed with 4× Sypro Orange dye in a Bio-Rad 384-well PCR white plate and covered with qPCR Sealing Tape. The assay was performed over 25°C to 95°C with a temperature ramp rate of 0.5°C/30 s on a Roche LC480 Light Cycler.

Lim S.A., Zhou J., Martinko A.J., Wang Y.H., Filippova E.V., Steri V., Wang D., Remesh S.G., Liu J., Hann B., Kossiakoff A.A., Evans M.J., Leung K.K, & Wells J.A. (2022). Targeting a proteolytic neoepitope on CUB domain containing protein 1 (CDCP1) for RAS-driven cancers. The Journal of Clinical Investigation, 132(4), e154604.

+ Open protocol

+ Expand

Quantification of miR-673-5p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA (100 ng) was used to quantify mmu-mmiR-673–5p levels. RNA was first converted to cDNA using miRCURY LNA RT kit (Qiagen). cDNA was diluted 1/25 for RT-qPCR using miRCURY LNA SYBR Green kit and amplified using mmu-mmiR-673–5p specific primers (Qiagen) and U6 as a loading control. Quantitative PCR was carried out on a Roche LC480 light cycler and analysed using the second derivative method.

Witteveldt J., Knol L.I, & Macias S. (2019). MicroRNA-deficient mouse embryonic stem cells acquire a functional interferon response. eLife, 8, e44171.

+ Open protocol

+ Expand

RNA extraction and qPCR analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from dissected organs, purified cells or brain (frontal cortex) was extracted using Mini RNA Kit (Zymo Research) with on-column DNAse treatment. Subsequently, 1 μg of isolated RNA was reverse transcribed (ReverseAid, Thermo Scientific) with anchored oligo(dT)₂₀ and random pentadecamers. qPCR was performed using SYBR Green chemistry (Roche) and LC480 Light Cycler (Roche) with extensively validated Prr7 and Gapdh specific primers (Prr7 F: GAC GAG TTC GAA GAG GAT GC, Prr7 R: GAG GGG CAA CTG TGG TTC, Gapdh F: ATG GTG AAG GTC GGT GTG A, Gapdh R: AAT CTC CAC TTT GCC ACT GC) in technical replicates. The relative Prr7 expression levels were calculated in Excel (Microsoft) using ΔΔCt method.

Hrdinka M., Sudan K., Just S., Drobek A., Stepanek O., Schlüter D., Reinhold D., Jordan B.A., Gintschel P., Schraven B, & Kreutz M.R. (2016). Normal Development and Function of T Cells in Proline Rich 7 (Prr7) Deficient Mice. PLoS ONE, 11(9), e0162863.

+ Open protocol

+ Expand

Quantifying mRNA and miRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRI reagent was used to isolate RNA according to the manufacturer’s instructions and 500 ng was reverse transcribed into cDNA using the Quantitect Reverse Transcription Kit (Qiagen). Oligonucleotide primers were synthesized (MWG Operon) and quantitative PCR reactions were performed in 20 µl containing 2 µl of template cDNA, SYBR Green MasterMix (Roche) and 10 pmol of each primer. For miRNA expression 100 ng of RNA was used in Taqman miRNA assays (Applied Biosystems) according to manufacturer’s instructions. A Roche LC 480 Lightcycler was used for amplification of both mRNA and miRNA in triplicate. Relative expression of mRNA and miRNA relative to GAPDH and U6 snRNA respectively was determined using the 2^−ΔΔCt method.

Hassan T., de Santi C., Mooney C., McElvaney N.G, & Greene C.M. (2017). Alpha-1 antitrypsin augmentation therapy decreases miR-199a-5p, miR-598 and miR-320a expression in monocytes via inhibition of NFκB. Scientific Reports, 7, 13803.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!