Jurkat T cells or HEK293T cells with or without MALAT1 knockout were infected with HIV/luc-VSV-G virus (1 ng p24gagag/1 × 106) for 2 days. Cells were then cross-linked in 1% formaldehyde for 10 min at room temperature and quenched with 0.125 M glycine for 5 min. After lysis, chromatin was sheared by sonication for 12 min (10 s on and 10 s off) on ice to obtain DNA fragments of 200 to 1000 bp. About 5% of the total sheared chromatin DNA was used as input. Sheared chromatin was incubated with an antibody against EZH2, H3K27me3 or H3K9me3. Rabbit and mouse IgG were used as negative controls. The immunoprecipitated DNA was analyzed by real-time PCR (ABI Prism 7900 real-time PCR system) for 30 cycles with Taq master mix (Invitrogen). The primers targeting for HIV LTR Nuc0, DHS, Nuc1 and Nuc2 regions had been described previously (68–70 ). Nuc0, forward, 5′-TGG ATC TAC CAC ACA CAA GG-3′ and reverse, 5′-GTA CTA ACT TGA AGC ACC ATC C-3′. DHS, forward, 5′-AAG TTT GAC AGC CTC CTA GC-3′ and reverse, 5′-CAC ACC TCC CTG GAA AGT C-3′. Nuc1, forward, 5′-TCT CTG GCT AAC TAG GGA ACC-3′ and reverse, 5′-CTA AAA GGG TCT GAG GGA TCT C-3′. Nuc2, forward, 5′-AGA GAT GGG TGC GAG AGC-3′ and reverse, 5′-ATT AAC TGC GAA TCG TTC TAG C-3′.
Abi prism 7900 real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, Denmark
The ABI PRISM 7900 Real-time PCR system is a high-throughput instrument designed for quantitative real-time PCR analysis. It provides precise and reliable detection and quantification of DNA and RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (15 mentions)
Trizol, by Thermo Fisher Scientific (7 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Sybr premix ex taq, by Takara Bio (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Taq master mix, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Sybr primescript rt pcr kit, by Takara Bio (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Rt reaction mix, by Qiagen (2 mentions)
Sybr green master mix, by Qiagen (2 mentions)
Primescripttm rt reagent kit, by Takara Bio (2 mentions)
Power sybr green, by Takara Bio (2 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
40 protocols using abi prism 7900 real time pcr system
1
Chromatin Immunoprecipitation of HIV-1 Epigenetics
2
RNA-binding Protein Immunoprecipitation (RIP)
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-binding protein immunoprecipitation (RIP) was performed in a native condition. Briefly, Jurkat T cells were lysed and cell nuclei were isolated and suspended in 1 ml ice-cold RIP Buffer (150 mM KCl, 25 mM Tris, pH 7.4, 5 mM ethylenediaminetetraacetic acid, 0.5 mM Dithiothreitol (DTT), 0.5% NP40, 100 U/ml RNAase and protease inhibitor cocktail). The chromatin was sheared by ultra-sonication and centrifuged for 10 min to remove debris, followed by incubation for immunoprecipitation with specific antibodies against EZH2, SUZ12 or EED. 5% of each sample was used as input. Rabbit or mouse IgG was used as a negative antibody control. The immunoprecipitated RNA was extracted using Trizol (Invitrogen) and analyzed by real-time (RT-) PCR (ABI Prism 7900 real-time PCR system) for 40 cycles with Taq master mix (Invitrogen), using primers specific for the MALAT1 detection, forward, 5′-CTT CCC TAG GGG ATT TCA GG-3′ and reverse, 5′-GCC CAC AGG AAC AAG TCC TA-3′.
3
Gene Expression Analysis of KCNE4 and EFEMP2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequently, the RNA was reverse transcribed into cDNA using a PrimeScript RT Kit (Takara Bio, Inc.). The RT conditions were performed at 30˚C as the priming stage for 10 min, 42˚C as the RT step for 30 min and 95˚C as the RT inactivation stage for 5 min. Then, qPCR reactions were performed on an ABI PRISM 7900 Real-Time PCR system (Thermo Fisher Scientific, Inc.) using SYBR Premix Ex Taq kit (Takara Bio, Inc.). The thermocycling conditions were as follows: 95˚C for 10 min, followed by 35 cycles of 95˚C for 15 sec and 65˚C for 60 sec. The sequences of the primers were as follows: KCNE4 forward: 5'-CACCGCTACCTGAAAACCCT-3' and reverse: 5'-TTGATCGTGGCAGAGTGAGC-3'; EFEMP2 forward: 5'-GAGTGTCTGACCATCCCTGAG-3' and reverse: 5'-GCCGTGTAGGTCGTTGATGAC-3'; GAPDH forward: 5'-CAGGAGGCATTGCTGATGAT-3' and reverse: 5'-GAAGGCTGGGGCTCATTT-3'. GAPDH served as the internal control. Relative gene expression levels of KCNE4 and EFEMP2 were normalized to GAPDH and calculated via the 2-ΔΔCq method (18 (link)).
4
Ivermectin Modulates Gene Expression in ESCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ESCC cells pre‐treated with increasing concentrations of ivermectin, and then the total mRNAs were isolated by using the TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Reverse transcription was conducted by using 1 mg of total RNA and PrimeScript RT Master Mix (TaKaRa). qRT‐PCR was conducted on an ABI Prism 7, 900 Real‐Time PCR System (Thermo Fisher Scientific) by using SYBR Premix Ex Taq II (TaKaRa). Fold enrichment was calculated performed with the 2−ΔΔCt method. GAPDH served as an internal control. The sequences of primers used for qRT‐PCR were as follows: GAPDH, 5′‐GAAGGTGAAGGTCGGAGTC‐3′ (forward) and 5′‐GAAGATGGTGATGGGATTTC‐3′ (reverse); PAK1, 5′‐CGCAGGCTGTTCTGGATGT‐3′ (forward) and 5′‐GTGGCACTGCAGGAGTCTCA‐3′ (reverse).
5
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Applied Biosystems software was used to design optimal primer pairs for quantitative RT-PCR. Total RNA was extracted from the cells using TRIZOL (Invitrogen) and the cDNA was synthesized from 2 µg aliquots of RNA, oligo(dT), and reverse transcriptase, according to the manufacturer’s protocol (Invitrogen). Amplifications of target genes were performed by real-time quantitative PCR (qPCR) using the cDNA as template, the specific primers and QuantiTect SYBR Green PCR kit (Qiangen, Hilden, Germany) on an ABI PRISM 7900 Real Time PCR System (Applied Biosystems, Carlsbad, USA). The gene expression changes were determined by using the method of 2-△△CT. The raw quantifications were normalized to the GAPDH values for each sample and fold changes were shown as Mean ± SD in three independent experiments with each triplicate.
6
Quantifying miR-204-3p in Bladder Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was applied for extracting total RNA containing miRNA to quantitate the miR-204-3p expression in bladder cancer tissues and cell lines. RNA was reverse transcribed using M-MLV Reverse Transcriptase from Promega (Promega, Madison, WI, USA) as per the manufacture’s introduction. Expression levels of miR-204-3p were normalized to that of rRNA U6B and then converted into relative values calculated by the comparative CT method. The primers of miR-204-3p and U6B were purchased from RiboBio Co., Ltd. (Guangzhou, China). qRT-PCR was performed through the SYBR Premix Ex Taq (Takara Bio, Inc., Otsu, Japan) on an ABI PRISM 7900 Real-time PCR system (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA). GAPDH was used as control of ROBO4. The primers were designed as follows:
GAPDH:
F: 5ʹ-GAGTCA ACGGATTTGGTCGT-3ʹ,
R: 5ʹ-TTGATTTTGGAGGGA TCTCG-3ʹ;
ROBO4:
F: 5ʹ-CATCCGCTGGTTGCTGAATG-3ʹ,
R: 5ʹ-CTGTAGCAGCAGAAGGGTCC-3ʹ.
The relative expression levels were analyzed using the 2−ΔΔCt method.
GAPDH:
F: 5ʹ-GAGTCA ACGGATTTGGTCGT-3ʹ,
R: 5ʹ-TTGATTTTGGAGGGA TCTCG-3ʹ;
ROBO4:
F: 5ʹ-CATCCGCTGGTTGCTGAATG-3ʹ,
R: 5ʹ-CTGTAGCAGCAGAAGGGTCC-3ʹ.
The relative expression levels were analyzed using the 2−ΔΔCt method.
7
Quantitative PCR Analysis of MC3T3-E1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the MC3T3-E1 cells from the eight groups (groups 1–4 and groups A–D) at the 3 time points (4, 7, and 14 days) was extracted using a RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturers protocol. After subsequent DNase digestion, 1 μg of RNA was used to synthetize 20 μL of cDNA using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA). Quantitative real time PCR reactions were performed in the ABI prism 7900 real time PCR system using the SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA). Expression in each sample was evaluated in three technical replicates. Sequences of the oligonucleotides used in this study are listed in Table 1 . Specificity of primer pairs and absence of primer dimmers was validated by analysis of the dissociation curves and the agarose gel electrophoresis. Comparative CT method was used for data analysis. Expression in each sample was normalized to the amount of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. Data represent mean expression from 3 experiments.
8
Quantitative PCR Analysis of miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The isolated serum RNA was first reverse transcribed using the TaqMan miRNA reverse transcription kit (Applied Biosystems) according to the instruction of the manufacturer. The quantitative PCR was performed using TaqMan microRNA assays (Applied Biosystems) in an ABI PRISM 7900 real-time PCR system. The primers of human miR-16, used as an endogenous control [20 (link)–23 (link)], were also purchased from Applied Biosystems. The assay ID number is 001141 for mir-451a, 001277 for mir-485-3p, 465290_mat for mir-4298, 000391 for mir-16. Reaction mixtures were incubated at 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Signals were detected at the end of each cycle. The cycle threshold (Ct) values were calculated with SDS 2.4 software (Applied Biosystems). The assays were undertaken in triplicate for all samples. 2–ΔCt represents the normalized miRNAs expression level.
9
Quantification of IL-6 mRNA in Macrophages
10
Validating RNA-Seq Differential Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR analyses with the three biological replicates samples used for RNA-Seq were performed to verify the DGEs results. Twenty-one common differentially expressed genes were randomly selected that accounted for about 22.1% of the 95 common differentially expressed genes. Specific primers were designed using the Primer-BLAST tool (available online: http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi? LINK _LOC=BlastHome ) in NCBI and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). cDNAs were reverse transcribed from total RNA using a PrimeScript RT reagent Kit (Takara, Dalian, China). qRT-PCR was carried out according to the SYBR PrimeScript RT-PCR Kit manufacturer specifications (Takara) on an ABI Prism®7900 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). To normalize the gene expression data, we used the broccoli β-actin gene as an internal standard [67 ]. The 2−ΔΔCt method [68 (link)] was used to determine the relative expression of genes. The standard deviation was calculated based on the three biological replicates. The specific primers sequences are listed in Table S6 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!